ID: 1129777760

View in Genome Browser
Species Human (GRCh38)
Location 15:78247923-78247945
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129777760_1129777764 -7 Left 1129777760 15:78247923-78247945 CCAAGCTTTCTGCATGCCAGGAC No data
Right 1129777764 15:78247939-78247961 CCAGGACCATGCTAGGCCAAGGG No data
1129777760_1129777765 -6 Left 1129777760 15:78247923-78247945 CCAAGCTTTCTGCATGCCAGGAC No data
Right 1129777765 15:78247940-78247962 CAGGACCATGCTAGGCCAAGGGG No data
1129777760_1129777762 -8 Left 1129777760 15:78247923-78247945 CCAAGCTTTCTGCATGCCAGGAC No data
Right 1129777762 15:78247938-78247960 GCCAGGACCATGCTAGGCCAAGG No data
1129777760_1129777768 13 Left 1129777760 15:78247923-78247945 CCAAGCTTTCTGCATGCCAGGAC No data
Right 1129777768 15:78247959-78247981 GGGGAGATAGTGCAAAAGAGAGG No data
1129777760_1129777769 30 Left 1129777760 15:78247923-78247945 CCAAGCTTTCTGCATGCCAGGAC No data
Right 1129777769 15:78247976-78247998 GAGAGGTGCAGCCCCTGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129777760 Original CRISPR GTCCTGGCATGCAGAAAGCT TGG (reversed) Intergenic