ID: 1129777762

View in Genome Browser
Species Human (GRCh38)
Location 15:78247938-78247960
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129777760_1129777762 -8 Left 1129777760 15:78247923-78247945 CCAAGCTTTCTGCATGCCAGGAC No data
Right 1129777762 15:78247938-78247960 GCCAGGACCATGCTAGGCCAAGG No data
1129777757_1129777762 29 Left 1129777757 15:78247886-78247908 CCGATTGGCATTTTAGAAAGCTG No data
Right 1129777762 15:78247938-78247960 GCCAGGACCATGCTAGGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129777762 Original CRISPR GCCAGGACCATGCTAGGCCA AGG Intergenic
No off target data available for this crispr