ID: 1129777763

View in Genome Browser
Species Human (GRCh38)
Location 15:78247939-78247961
Sequence CCCTTGGCCTAGCATGGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129777763_1129777772 19 Left 1129777763 15:78247939-78247961 CCAGGACCATGCTAGGCCAAGGG No data
Right 1129777772 15:78247981-78248003 GTGCAGCCCCTGCCTTGGGTGGG No data
1129777763_1129777773 20 Left 1129777763 15:78247939-78247961 CCAGGACCATGCTAGGCCAAGGG No data
Right 1129777773 15:78247982-78248004 TGCAGCCCCTGCCTTGGGTGGGG No data
1129777763_1129777768 -3 Left 1129777763 15:78247939-78247961 CCAGGACCATGCTAGGCCAAGGG No data
Right 1129777768 15:78247959-78247981 GGGGAGATAGTGCAAAAGAGAGG No data
1129777763_1129777771 18 Left 1129777763 15:78247939-78247961 CCAGGACCATGCTAGGCCAAGGG No data
Right 1129777771 15:78247980-78248002 GGTGCAGCCCCTGCCTTGGGTGG No data
1129777763_1129777770 15 Left 1129777763 15:78247939-78247961 CCAGGACCATGCTAGGCCAAGGG No data
Right 1129777770 15:78247977-78247999 AGAGGTGCAGCCCCTGCCTTGGG No data
1129777763_1129777769 14 Left 1129777763 15:78247939-78247961 CCAGGACCATGCTAGGCCAAGGG No data
Right 1129777769 15:78247976-78247998 GAGAGGTGCAGCCCCTGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129777763 Original CRISPR CCCTTGGCCTAGCATGGTCC TGG (reversed) Intergenic
No off target data available for this crispr