ID: 1129777765

View in Genome Browser
Species Human (GRCh38)
Location 15:78247940-78247962
Sequence CAGGACCATGCTAGGCCAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129777760_1129777765 -6 Left 1129777760 15:78247923-78247945 CCAAGCTTTCTGCATGCCAGGAC No data
Right 1129777765 15:78247940-78247962 CAGGACCATGCTAGGCCAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129777765 Original CRISPR CAGGACCATGCTAGGCCAAG GGG Intergenic
No off target data available for this crispr