ID: 1129777766

View in Genome Browser
Species Human (GRCh38)
Location 15:78247945-78247967
Sequence TATCTCCCCTTGGCCTAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129777766_1129777769 8 Left 1129777766 15:78247945-78247967 CCATGCTAGGCCAAGGGGAGATA No data
Right 1129777769 15:78247976-78247998 GAGAGGTGCAGCCCCTGCCTTGG No data
1129777766_1129777768 -9 Left 1129777766 15:78247945-78247967 CCATGCTAGGCCAAGGGGAGATA No data
Right 1129777768 15:78247959-78247981 GGGGAGATAGTGCAAAAGAGAGG No data
1129777766_1129777773 14 Left 1129777766 15:78247945-78247967 CCATGCTAGGCCAAGGGGAGATA No data
Right 1129777773 15:78247982-78248004 TGCAGCCCCTGCCTTGGGTGGGG No data
1129777766_1129777771 12 Left 1129777766 15:78247945-78247967 CCATGCTAGGCCAAGGGGAGATA No data
Right 1129777771 15:78247980-78248002 GGTGCAGCCCCTGCCTTGGGTGG No data
1129777766_1129777770 9 Left 1129777766 15:78247945-78247967 CCATGCTAGGCCAAGGGGAGATA No data
Right 1129777770 15:78247977-78247999 AGAGGTGCAGCCCCTGCCTTGGG No data
1129777766_1129777778 29 Left 1129777766 15:78247945-78247967 CCATGCTAGGCCAAGGGGAGATA No data
Right 1129777778 15:78247997-78248019 GGGTGGGGCTGTAGCATCATTGG No data
1129777766_1129777772 13 Left 1129777766 15:78247945-78247967 CCATGCTAGGCCAAGGGGAGATA No data
Right 1129777772 15:78247981-78248003 GTGCAGCCCCTGCCTTGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129777766 Original CRISPR TATCTCCCCTTGGCCTAGCA TGG (reversed) Intergenic