ID: 1129777767

View in Genome Browser
Species Human (GRCh38)
Location 15:78247955-78247977
Sequence TCTTTTGCACTATCTCCCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129777767_1129777770 -1 Left 1129777767 15:78247955-78247977 CCAAGGGGAGATAGTGCAAAAGA No data
Right 1129777770 15:78247977-78247999 AGAGGTGCAGCCCCTGCCTTGGG No data
1129777767_1129777771 2 Left 1129777767 15:78247955-78247977 CCAAGGGGAGATAGTGCAAAAGA No data
Right 1129777771 15:78247980-78248002 GGTGCAGCCCCTGCCTTGGGTGG No data
1129777767_1129777772 3 Left 1129777767 15:78247955-78247977 CCAAGGGGAGATAGTGCAAAAGA No data
Right 1129777772 15:78247981-78248003 GTGCAGCCCCTGCCTTGGGTGGG No data
1129777767_1129777778 19 Left 1129777767 15:78247955-78247977 CCAAGGGGAGATAGTGCAAAAGA No data
Right 1129777778 15:78247997-78248019 GGGTGGGGCTGTAGCATCATTGG No data
1129777767_1129777769 -2 Left 1129777767 15:78247955-78247977 CCAAGGGGAGATAGTGCAAAAGA No data
Right 1129777769 15:78247976-78247998 GAGAGGTGCAGCCCCTGCCTTGG No data
1129777767_1129777773 4 Left 1129777767 15:78247955-78247977 CCAAGGGGAGATAGTGCAAAAGA No data
Right 1129777773 15:78247982-78248004 TGCAGCCCCTGCCTTGGGTGGGG No data
1129777767_1129777779 22 Left 1129777767 15:78247955-78247977 CCAAGGGGAGATAGTGCAAAAGA No data
Right 1129777779 15:78248000-78248022 TGGGGCTGTAGCATCATTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129777767 Original CRISPR TCTTTTGCACTATCTCCCCT TGG (reversed) Intergenic
No off target data available for this crispr