ID: 1129777769

View in Genome Browser
Species Human (GRCh38)
Location 15:78247976-78247998
Sequence GAGAGGTGCAGCCCCTGCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129777767_1129777769 -2 Left 1129777767 15:78247955-78247977 CCAAGGGGAGATAGTGCAAAAGA No data
Right 1129777769 15:78247976-78247998 GAGAGGTGCAGCCCCTGCCTTGG No data
1129777760_1129777769 30 Left 1129777760 15:78247923-78247945 CCAAGCTTTCTGCATGCCAGGAC No data
Right 1129777769 15:78247976-78247998 GAGAGGTGCAGCCCCTGCCTTGG No data
1129777766_1129777769 8 Left 1129777766 15:78247945-78247967 CCATGCTAGGCCAAGGGGAGATA No data
Right 1129777769 15:78247976-78247998 GAGAGGTGCAGCCCCTGCCTTGG No data
1129777763_1129777769 14 Left 1129777763 15:78247939-78247961 CCAGGACCATGCTAGGCCAAGGG No data
Right 1129777769 15:78247976-78247998 GAGAGGTGCAGCCCCTGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129777769 Original CRISPR GAGAGGTGCAGCCCCTGCCT TGG Intergenic
No off target data available for this crispr