ID: 1129777771

View in Genome Browser
Species Human (GRCh38)
Location 15:78247980-78248002
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129777763_1129777771 18 Left 1129777763 15:78247939-78247961 CCAGGACCATGCTAGGCCAAGGG No data
Right 1129777771 15:78247980-78248002 GGTGCAGCCCCTGCCTTGGGTGG No data
1129777766_1129777771 12 Left 1129777766 15:78247945-78247967 CCATGCTAGGCCAAGGGGAGATA No data
Right 1129777771 15:78247980-78248002 GGTGCAGCCCCTGCCTTGGGTGG No data
1129777767_1129777771 2 Left 1129777767 15:78247955-78247977 CCAAGGGGAGATAGTGCAAAAGA No data
Right 1129777771 15:78247980-78248002 GGTGCAGCCCCTGCCTTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129777771 Original CRISPR GGTGCAGCCCCTGCCTTGGG TGG Intergenic
No off target data available for this crispr