ID: 1129777779 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 15:78248000-78248022 |
Sequence | TGGGGCTGTAGCATCATTGG AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1129777774_1129777779 | -10 | Left | 1129777774 | 15:78247987-78248009 | CCCCTGCCTTGGGTGGGGCTGTA | No data | ||
Right | 1129777779 | 15:78248000-78248022 | TGGGGCTGTAGCATCATTGGAGG | No data | ||||
1129777767_1129777779 | 22 | Left | 1129777767 | 15:78247955-78247977 | CCAAGGGGAGATAGTGCAAAAGA | No data | ||
Right | 1129777779 | 15:78248000-78248022 | TGGGGCTGTAGCATCATTGGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1129777779 | Original CRISPR | TGGGGCTGTAGCATCATTGG AGG | Intergenic | ||