ID: 1129779121

View in Genome Browser
Species Human (GRCh38)
Location 15:78257871-78257893
Sequence TACAAAAAGCCCAATAGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129779121_1129779128 15 Left 1129779121 15:78257871-78257893 CCCACCCTATTGGGCTTTTTGTA No data
Right 1129779128 15:78257909-78257931 CTTCTAGGCAGATGCATGTATGG No data
1129779121_1129779125 0 Left 1129779121 15:78257871-78257893 CCCACCCTATTGGGCTTTTTGTA No data
Right 1129779125 15:78257894-78257916 TTTCCAAATAGAATCCTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129779121 Original CRISPR TACAAAAAGCCCAATAGGGT GGG (reversed) Intergenic
No off target data available for this crispr