ID: 1129779215

View in Genome Browser
Species Human (GRCh38)
Location 15:78258984-78259006
Sequence CTGGAGGTTGAGAAGGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129779215_1129779223 27 Left 1129779215 15:78258984-78259006 CCTGGCTCCTTCTCAACCTCCAG No data
Right 1129779223 15:78259034-78259056 CTGACCACCCAGAATTCAAAAGG No data
1129779215_1129779218 -9 Left 1129779215 15:78258984-78259006 CCTGGCTCCTTCTCAACCTCCAG No data
Right 1129779218 15:78258998-78259020 AACCTCCAGGATTCATGCGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129779215 Original CRISPR CTGGAGGTTGAGAAGGAGCC AGG (reversed) Intergenic
No off target data available for this crispr