ID: 1129780088

View in Genome Browser
Species Human (GRCh38)
Location 15:78264412-78264434
Sequence CCAGACCCCCGACGCCCGTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 90}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129780088_1129780093 -3 Left 1129780088 15:78264412-78264434 CCGGACGGGCGTCGGGGGTCTGG 0: 1
1: 0
2: 0
3: 5
4: 90
Right 1129780093 15:78264432-78264454 TGGGCCGCGAACCCGCCGCGGGG 0: 1
1: 0
2: 0
3: 4
4: 48
1129780088_1129780102 25 Left 1129780088 15:78264412-78264434 CCGGACGGGCGTCGGGGGTCTGG 0: 1
1: 0
2: 0
3: 5
4: 90
Right 1129780102 15:78264460-78264482 GGAACCTCCGCGAAGGTTCTAGG 0: 1
1: 0
2: 0
3: 3
4: 44
1129780088_1129780095 4 Left 1129780088 15:78264412-78264434 CCGGACGGGCGTCGGGGGTCTGG 0: 1
1: 0
2: 0
3: 5
4: 90
Right 1129780095 15:78264439-78264461 CGAACCCGCCGCGGGGCCGCCGG 0: 1
1: 0
2: 1
3: 9
4: 131
1129780088_1129780099 18 Left 1129780088 15:78264412-78264434 CCGGACGGGCGTCGGGGGTCTGG 0: 1
1: 0
2: 0
3: 5
4: 90
Right 1129780099 15:78264453-78264475 GGCCGCCGGAACCTCCGCGAAGG 0: 1
1: 0
2: 4
3: 8
4: 65
1129780088_1129780092 -4 Left 1129780088 15:78264412-78264434 CCGGACGGGCGTCGGGGGTCTGG 0: 1
1: 0
2: 0
3: 5
4: 90
Right 1129780092 15:78264431-78264453 CTGGGCCGCGAACCCGCCGCGGG 0: 1
1: 0
2: 1
3: 7
4: 70
1129780088_1129780091 -5 Left 1129780088 15:78264412-78264434 CCGGACGGGCGTCGGGGGTCTGG 0: 1
1: 0
2: 0
3: 5
4: 90
Right 1129780091 15:78264430-78264452 TCTGGGCCGCGAACCCGCCGCGG 0: 1
1: 0
2: 0
3: 1
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129780088 Original CRISPR CCAGACCCCCGACGCCCGTC CGG (reversed) Intronic
900082645 1:870011-870033 CCAGGACCCCGACGCCCAGCCGG + Intergenic
900095902 1:940024-940046 CCAGGCCCCAGCCGCCCGCCTGG + Intronic
901234672 1:7661523-7661545 CCAGACCCCCTGCTCCCATCGGG - Intronic
901491984 1:9601386-9601408 CCAGTGCCACGACGCCCGTCTGG - Exonic
908582043 1:65525983-65526005 CCCCACCCCCGCCGCCCGCCGGG - Intronic
909224798 1:73005896-73005918 CCACACCCCCAAACCCCGTCCGG + Intergenic
915618700 1:157064504-157064526 CCAGCCCCCCAACCCCCGACAGG + Intergenic
1063973424 10:11397124-11397146 CCTGACCCCTGACGCCCAGCCGG + Intergenic
1064709597 10:18109835-18109857 CCACACCCCTGTCGCACGTCAGG + Intergenic
1065599752 10:27356583-27356605 CCAGTCCTCCTACGCCCCTCTGG - Intergenic
1067015280 10:42753602-42753624 CCAGGTCCCCGACACCCGCCAGG + Intergenic
1067153655 10:43756867-43756889 CCAGCCCCCCAACCCCCGACAGG + Intergenic
1070734257 10:78852626-78852648 CCTGACCCTCGATGCCCGGCAGG + Intergenic
1076373037 10:129967153-129967175 CCGGCCCCCGGACGCCGGTCTGG - Intergenic
1076999594 11:315987-316009 GCGCACCCCCGACGCCCGTGGGG - Intergenic
1090829113 11:130408691-130408713 CCACACCCCCGCCCCCCGGCAGG - Intronic
1092327620 12:7549922-7549944 CCAGACCCCCAACCCCTGACAGG - Intergenic
1100226997 12:92568077-92568099 CCAGACCCCCACCCCCCGACAGG - Intergenic
1102371003 12:112382291-112382313 CCATACCCCCGACCCCGGCCCGG + Intronic
1103561078 12:121793588-121793610 CCAGACCGCCGCCCCCGGTCCGG - Exonic
1114031444 14:18583953-18583975 CCAGGACCCCGACGCCCAGCCGG + Intergenic
1119743255 14:77027562-77027584 CCGGGCCGCCGCCGCCCGTCGGG - Exonic
1122630003 14:103103416-103103438 CCTGAACCCAGATGCCCGTCTGG - Intronic
1122744981 14:103892080-103892102 CCAGACCCCCGCTGCCCTTTCGG - Intergenic
1129780088 15:78264412-78264434 CCAGACCCCCGACGCCCGTCCGG - Intronic
1132748605 16:1447192-1447214 CCTGAGCCCCCACGCCCGTCTGG + Intronic
1133156405 16:3879971-3879993 CAGGGCCCCCGACCCCCGTCCGG - Exonic
1133762775 16:8813278-8813300 TCAGACCCCCGACGCCTCTGTGG + Intronic
1135727667 16:24869576-24869598 CCCGACCCCCGACCCCCGCAGGG + Intronic
1140442793 16:74999782-74999804 CCATGGCCCCGCCGCCCGTCCGG - Exonic
1142336019 16:89490114-89490136 CCCGACCCCCCAGGCCCGCCCGG + Intronic
1143045650 17:4076814-4076836 GCAGACCCCCAACCCCCTTCCGG + Intronic
1144724856 17:17496641-17496663 CCAGAACCCCGACGCCCCTGCGG - Intergenic
1146283577 17:31559957-31559979 CCAGCCCCGGGAAGCCCGTCGGG + Intergenic
1147634521 17:41955331-41955353 CCTGACACCCGAAGCCCGGCGGG - Intronic
1147948463 17:44093525-44093547 CCAGACCTCCGATCCCCGCCCGG - Intronic
1148855427 17:50576383-50576405 CCAGACCCCCTAGTCCCCTCTGG - Intronic
1163607180 19:18281735-18281757 CCAAGCCGCCGACGCCCGCCCGG + Intergenic
1166861995 19:45816316-45816338 CCAGACCCCCAACTCCCAGCAGG + Intronic
1168288790 19:55347191-55347213 CCAGCCCCCCCACGCCCGCTGGG + Exonic
1168689478 19:58368256-58368278 CCCGGCTCCCGACCCCCGTCGGG + Exonic
926212463 2:10880837-10880859 CCATACCCCCGCCTCCCGCCTGG + Intergenic
927572749 2:24174768-24174790 CGAGGCCCCCGCCGCCCTTCTGG - Intronic
932532752 2:72554903-72554925 CCAGACCCCCAACCCCTGACAGG + Intronic
938496759 2:131801842-131801864 CCAGGACCCCGACGCCCAGCCGG - Intergenic
939812084 2:146846025-146846047 CCAGCCCCCCAACCCCCGACAGG - Intergenic
947758730 2:232588078-232588100 CTAGCCCCCCGACCCCCATCAGG + Intergenic
1169213026 20:3778151-3778173 CCAGAGCCCCGACGCCGCGCCGG - Exonic
1169893107 20:10474625-10474647 CCAGGCCCCCAAGGCCCATCTGG - Intronic
1171506632 20:25641776-25641798 CCAGACTCCCGATGCCCTTTTGG - Intergenic
1179836065 21:44034340-44034362 CCCCACCCCCGCCGCCCCTCAGG + Intronic
1180455557 22:15511010-15511032 CCAGGACCCCGACGCCCAGCCGG + Intergenic
1180762403 22:18220170-18220192 CCAGAGCCACGACACCCGCCTGG - Intergenic
1180773265 22:18404438-18404460 CCAGAGCCACGACACCCGCCTGG + Intergenic
1180804618 22:18653987-18654009 CCAGAGCCACGACACCCGCCTGG + Intergenic
1180806130 22:18715423-18715445 CCAGAGCCACGACACCCGCCTGG - Intergenic
1181192361 22:21151371-21151393 CCAGAGCCACGACACCCGCCTGG + Intergenic
1181217078 22:21341204-21341226 CCAGAGCCACGACACCCGCCTGG - Intergenic
1181684602 22:24519874-24519896 CCAGGCCCCCGGCTCCCTTCTGG + Intronic
1182122717 22:27797860-27797882 CCAGGACCCGGAGGCCCGTCCGG - Exonic
1184337603 22:43862861-43862883 CCAGGGCCCCGACACGCGTCAGG + Intergenic
1203235095 22_KI270731v1_random:145420-145442 CCAGAGCCACGACACCCGCCTGG + Intergenic
949943816 3:9174707-9174729 CCAGCCCCCTCACTCCCGTCTGG - Intronic
954473867 3:50724679-50724701 CCAGACCCCCATCCCCCGACAGG - Intronic
960055614 3:113274486-113274508 CCAGACCCCCAACGTCAGTGGGG + Exonic
961815567 3:129548425-129548447 TCAGACACCTGACGCCCCTCTGG - Intronic
968230746 3:197003333-197003355 CCAGAGCTCCGATGCCCGCCCGG - Exonic
968878793 4:3288190-3288212 CCAGACCCCACACACCCGCCGGG - Intergenic
970395012 4:15656110-15656132 CCCCACCCCCAAGGCCCGTCGGG - Intronic
972345748 4:38191016-38191038 CCATACCCCAGAGGCCCGTAGGG + Intergenic
982232672 4:153223133-153223155 CCAGCCCCGCAGCGCCCGTCCGG - Intronic
985546904 5:514450-514472 CCTGCCCCCCGAGGCCCATCGGG + Intronic
985706933 5:1406799-1406821 CCCGACCCCCAACCCCCGCCAGG + Intronic
990536115 5:56724412-56724434 CCAGCCCCCCACCGCCCGACAGG + Intergenic
990713938 5:58615332-58615354 CCAGACCCCCAAATCCAGTCTGG + Intronic
996031613 5:118711767-118711789 CATGACCCCCGACTCCAGTCTGG + Intergenic
997229288 5:132230997-132231019 CCAGACCTCCCAGGCCAGTCGGG - Intronic
998366891 5:141637654-141637676 CAGGGCCCCCGACGCCCTTCCGG - Exonic
999279806 5:150357728-150357750 CCATACCCGCGACCCCCGGCCGG - Exonic
999525110 5:152396618-152396640 CCTGAGCCACCACGCCCGTCAGG - Intronic
1000126393 5:158248229-158248251 CCAGATCCCCCTCACCCGTCTGG + Intergenic
1002642780 5:180638368-180638390 CCAGACCACTGAAGCCTGTCAGG + Intronic
1020016635 7:4835381-4835403 CCAGAACCCCGACGGCTCTCAGG + Intronic
1029735703 7:102464797-102464819 CGAGACCCCCGAAGTCCTTCGGG - Exonic
1031032632 7:116751415-116751437 CTAGACCCCCGCCACCCGACAGG - Intronic
1031092220 7:117372245-117372267 CCAGTCCCCCGATCCCTGTCAGG + Intronic
1045516495 8:102864476-102864498 CCCGACCCCCGCCGCCTCTCGGG + Exonic
1049585370 8:143430433-143430455 CCACTCCCACGCCGCCCGTCGGG - Intergenic
1050559562 9:6820868-6820890 CCAGCCCCCCAACCCCCGACAGG + Intronic
1061859389 9:133460284-133460306 GCAGACCCCCGACCCCCAGCGGG - Intronic
1062009849 9:134261080-134261102 CCTGACCCCCGGAGCCCTTCGGG - Intergenic
1062501905 9:136855277-136855299 CCAGACCCACGACGCCCCCCGGG - Exonic
1188006066 X:25016434-25016456 CTGGCCCCCCGACGCCCGTCCGG - Intergenic
1188044320 X:25408385-25408407 CCAGCCCCCCAACCCCCGACAGG + Intergenic
1195056192 X:101147382-101147404 CTTGACCCCCGACCCCCGACAGG + Intronic
1198316876 X:135476869-135476891 CCAGACCCCTGAAGCCAGTTAGG - Intergenic