ID: 1129780094

View in Genome Browser
Species Human (GRCh38)
Location 15:78264436-78264458
Sequence GCGGCCCCGCGGCGGGTTCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 190}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129780094_1129780102 1 Left 1129780094 15:78264436-78264458 CCGCGAACCCGCCGCGGGGCCGC 0: 1
1: 0
2: 0
3: 12
4: 190
Right 1129780102 15:78264460-78264482 GGAACCTCCGCGAAGGTTCTAGG 0: 1
1: 0
2: 0
3: 3
4: 44
1129780094_1129780099 -6 Left 1129780094 15:78264436-78264458 CCGCGAACCCGCCGCGGGGCCGC 0: 1
1: 0
2: 0
3: 12
4: 190
Right 1129780099 15:78264453-78264475 GGCCGCCGGAACCTCCGCGAAGG 0: 1
1: 0
2: 4
3: 8
4: 65
1129780094_1129780105 10 Left 1129780094 15:78264436-78264458 CCGCGAACCCGCCGCGGGGCCGC 0: 1
1: 0
2: 0
3: 12
4: 190
Right 1129780105 15:78264469-78264491 GCGAAGGTTCTAGGCCTTTGTGG 0: 1
1: 0
2: 0
3: 6
4: 66
1129780094_1129780107 29 Left 1129780094 15:78264436-78264458 CCGCGAACCCGCCGCGGGGCCGC 0: 1
1: 0
2: 0
3: 12
4: 190
Right 1129780107 15:78264488-78264510 GTGGCGTCACCGTCTCCTTGCGG 0: 1
1: 0
2: 0
3: 5
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129780094 Original CRISPR GCGGCCCCGCGGCGGGTTCG CGG (reversed) Intronic
900571514 1:3360927-3360949 GCCGTCCCGCGGCGGGAACGAGG + Intronic
901066645 1:6497463-6497485 GCGGCCCCGCCTCGGGGGCGGGG + Intronic
902033418 1:13439324-13439346 GCGGGCCAGCGGCGAGTTCCGGG + Intergenic
902823381 1:18956716-18956738 GCGGGGCCGCGGCGGGGGCGGGG - Intergenic
903044173 1:20553350-20553372 GCAGCGCCGCCGGGGGTTCGGGG + Exonic
904030810 1:27532403-27532425 GCGGCCCAGAGGAGGTTTCGGGG - Intergenic
904181415 1:28669025-28669047 GCGGCGCCGCGGGGGGGTGGGGG + Intronic
904775157 1:32901623-32901645 GCGGGCCCGCGGCAAGTTGGGGG + Intergenic
905648283 1:39639702-39639724 GCGCCCCCGAGGCGGGGCCGGGG - Exonic
905685143 1:39902231-39902253 GCGGCCCGGCGGCCGCTTGGCGG + Intronic
906365583 1:45206620-45206642 GCGGGCCCGCGGCGCGCTCCAGG + Intronic
906650395 1:47508621-47508643 GCAGCCCCCCGGCGGGGGCGGGG - Intergenic
907038417 1:51236598-51236620 GCGGCCCCTCGGCGGCACCGTGG + Exonic
914044124 1:144077267-144077289 GCGGCACCGCGGCGGGTGGGGGG - Intergenic
914702895 1:150150198-150150220 GCGGCCCCGCGTCGGGGCCTCGG - Exonic
918078753 1:181190128-181190150 GCAGCCCCGCTGCGGGCTGGGGG - Intergenic
1063429636 10:5977470-5977492 ATGGCCCCGCGGCGGGCGCGCGG - Exonic
1065025239 10:21534553-21534575 GGGGCGCCGGGGCGGGCTCGGGG + Intronic
1067768880 10:49109346-49109368 GCGGCCCTGCGGTGGGCTGGGGG + Intronic
1067769899 10:49115543-49115565 GCGGGCCCGGGGCGGGCTGGCGG - Intergenic
1073099453 10:100999303-100999325 CCTGCCCCACGGCGGGTTGGAGG - Intronic
1075083170 10:119397260-119397282 GTGGCCCCGAGGTGGGGTCGGGG - Intronic
1076116842 10:127907038-127907060 GTGGCTCCGCGGCGGGGGCGGGG - Intergenic
1076395863 10:130136824-130136846 GCGGCCCCGCCGCGGGACGGAGG + Intronic
1077098540 11:810374-810396 GGGGCCCCACGGCGGCTGCGGGG - Intronic
1077100426 11:819984-820006 GGGGCCCCGCGGCGAGTCGGTGG + Intronic
1079362003 11:19777285-19777307 GCGGCCCCGGGGCGGGGGCGAGG + Intronic
1080836373 11:35944295-35944317 GCGGCCCCTCGGCAGGGTCCGGG - Intronic
1081549117 11:44095951-44095973 GCGGCCGCGCGGAGGCTCCGTGG + Intronic
1082784885 11:57311373-57311395 GCAGCCCCAAGGCGGGTTGGGGG - Intronic
1083457173 11:62786950-62786972 GCGGCCCCGCGTCGGCCTCTGGG + Exonic
1083890296 11:65592508-65592530 GCGCGCTCGCGGCGGGTGCGGGG + Exonic
1084010906 11:66347768-66347790 GCGGCCGAGCGGCGGGGCCGTGG - Intergenic
1086349887 11:85934903-85934925 CTGGTACCGCGGCGGGTTCGAGG - Intergenic
1089513846 11:119018982-119019004 TCGGGCCCGTGGCGGGTGCGGGG + Intronic
1090699149 11:129279152-129279174 GCGGCGGCGCGGCGGGGCCGCGG - Intronic
1093435275 12:19129560-19129582 GCCGCCCCGCCGCGCGCTCGGGG - Intergenic
1096634352 12:52949054-52949076 GCGGCTCCGGGGCGGGGGCGGGG + Exonic
1101371726 12:104137605-104137627 GGGGCCGCGCGGCGGGTGGGAGG - Intronic
1104001635 12:124863972-124863994 GCGGGCCCGGGGCGGGGTCGGGG + Intronic
1104602353 12:130162316-130162338 GCCGCCCCGCCGCGGGCTCCCGG - Intergenic
1104901161 12:132190197-132190219 GCGGCCGCGCGGCGGGAGAGGGG - Intergenic
1104957859 12:132474943-132474965 GGGGCACCGCGGGGGGTGCGGGG - Intergenic
1113082725 13:106535180-106535202 GCGGCGGCGCGGCGGACTCGGGG + Intergenic
1113820276 13:113208728-113208750 GCGCACCCGCGGCGGGGCCGGGG - Intronic
1118289391 14:64505326-64505348 GCGGCTCGGCGGCGGGTGGGAGG + Intronic
1120788019 14:88554711-88554733 GCGGCCGCGCGGCGGGGCCCCGG - Exonic
1121535732 14:94689658-94689680 GCCGCCTCGTGGCGGGTGCGGGG - Intergenic
1122108793 14:99480901-99480923 GCGGCCCGGGGGCGGGGTCCGGG - Intergenic
1124497583 15:30195930-30195952 GCGGCCCCGCGGGGTGGTCGTGG + Intergenic
1124746006 15:32342761-32342783 GCGGCCCCGCGGGGTGGTCGTGG - Intergenic
1129483151 15:75843563-75843585 CCGGCCCCGCGGGGCGGTCGCGG + Exonic
1129780094 15:78264436-78264458 GCGGCCCCGCGGCGGGTTCGCGG - Intronic
1132480588 16:164736-164758 GGGGCCGCGGGGCGGGGTCGCGG + Intronic
1132499900 16:280638-280660 GCGGCTCCTCGGCGGCTCCGCGG + Exonic
1132519688 16:381565-381587 GGGTCCCCGCCGCGGGTTGGGGG - Intronic
1132554414 16:566284-566306 GCTGCCCCGAGGCAGGGTCGGGG - Intergenic
1132622392 16:874030-874052 GAGGCCCGGCGGCGGGTGTGAGG + Intronic
1132753492 16:1470459-1470481 GCTGCCCCGCGGGGGGATGGGGG + Intronic
1132789506 16:1677986-1678008 GCGGCCCCGCGGTCGGCTCGCGG + Intronic
1132851473 16:2026808-2026830 GCGGCCGGGCGGCGGGGGCGGGG + Intronic
1135712597 16:24730063-24730085 GCGGTCCCGCGGCGCGGGCGAGG - Intronic
1137426579 16:48385410-48385432 GGGGGCGCGCGGCGGGCTCGAGG - Intronic
1139386987 16:66579238-66579260 GCCGCTCCGCTGCGGGGTCGGGG - Intergenic
1140078422 16:71723267-71723289 CCGGCGCCGCGGAGGGTTCGGGG - Intronic
1142018022 16:87762076-87762098 GTGGCTCCGCGGCGGGTCCTGGG - Intronic
1142293021 16:89201357-89201379 GCGGGCCCGGGGCGGGTGCAGGG + Intronic
1142395350 16:89828573-89828595 GCGGCGCCGCGGCGGGCGCAGGG + Exonic
1142763832 17:2055406-2055428 GCGGCTCCGCGCCGGGTTCACGG + Intronic
1143181571 17:4987235-4987257 GCGGCCCCCCGGCGGAGTGGTGG + Intronic
1144062777 17:11598681-11598703 GCGGCCCCTCGGCAGCATCGCGG - Exonic
1146975737 17:37109959-37109981 GCGGCCCTGCGGCTTGTTTGTGG + Intronic
1148323707 17:46771707-46771729 GCGGCCCGGCGCCGGGGCCGGGG - Intronic
1148323784 17:46771919-46771941 GCGGCGGCGCGGCGGGCCCGAGG - Intronic
1148787115 17:50150853-50150875 GCGACACCGCGGCTGCTTCGCGG - Intergenic
1150675735 17:67245017-67245039 GCGGCCCCGGGGCAGGCTGGGGG - Intronic
1155258080 18:24015254-24015276 GCGGGCGCGCGGCGGGTCCCGGG - Intronic
1160597763 18:79988806-79988828 GCGGCCTCGGGGCGGGAGCGTGG - Intronic
1160778324 19:866791-866813 GCGGGCCCGCGGCGGGTGGACGG - Intergenic
1162113396 19:8413462-8413484 GCGGGCCGGCCCCGGGTTCGAGG + Intronic
1162683795 19:12365429-12365451 GCGTCCCCGCGGCGACTGCGGGG - Intronic
1162921704 19:13906689-13906711 GGGGCCCTGCCCCGGGTTCGGGG + Intronic
1162951370 19:14073635-14073657 GCGGCTCCTCGGCGGGGGCGGGG + Exonic
1163282326 19:16325365-16325387 GCGGGGGCGCGCCGGGTTCGGGG - Exonic
1163708655 19:18832498-18832520 CCGGGCCCGAGGCGAGTTCGGGG - Intronic
1163824537 19:19515644-19515666 GTGGCCCCGGGGCGGGGTCCCGG - Exonic
1165511492 19:36268988-36269010 GCGGCGACGCGGCGGCTGCGGGG - Intergenic
1165512040 19:36271511-36271533 GCGGCGACGCGGCGGCTGCGGGG - Intergenic
1165512588 19:36274010-36274032 GCGGCGACGCGGCGGCTGCGGGG - Intergenic
1165513139 19:36276553-36276575 GCGGCGACGCGGCGGCTGCGGGG - Intergenic
1165513694 19:36279106-36279128 GCGGCGACGCGGCGGCTGCGGGG - Intergenic
1165514243 19:36281640-36281662 GCGGCGACGCGGCGGCTGCGGGG - Intergenic
1165514797 19:36284179-36284201 GCGGCGACGCGGCGGCTGCGGGG - Intergenic
1165515349 19:36286710-36286732 GCGGCGACGCGGCGGCTGCGGGG - Intergenic
1165515899 19:36289248-36289270 GCGGCGACGCGGCGGCTGCGGGG - Intergenic
1165516450 19:36291783-36291805 GCGGCGACGCGGCGGCTGCGGGG - Intergenic
1165517002 19:36294311-36294333 GCGGCGACGCGGCGGCTGCGGGG - Intergenic
1165517555 19:36296834-36296856 GCGGCGACGCGGCGGCTGCGGGG - Intergenic
1165518107 19:36299369-36299391 GCGGCGACGCGGCGGCTGCGGGG - Intergenic
1165518658 19:36301904-36301926 GCGGCGACGCGGCGGCTGCGGGG - Intergenic
1165519206 19:36304434-36304456 GCGGCGACGCGGCGGCTGCGGGG - Intergenic
1165519755 19:36306949-36306971 GCGGCGACGCGGCGGCTGCGGGG - Intergenic
1165520306 19:36309479-36309501 GCGGCGACGCGGCGGCTGCGGGG - Intergenic
1165623764 19:37269103-37269125 GCGGCGACGCGGCGGCTGCGGGG + Intergenic
1165624307 19:37271643-37271665 GCGGCGACGCGGCGGCTGCGGGG + Intergenic
1165624854 19:37274170-37274192 GCGGCGACGCGGCGGCTGCGGGG + Intergenic
1165625391 19:37276708-37276730 GCGGCGACGCGGCGGCTGCGGGG + Intergenic
1165625924 19:37279233-37279255 GCGGCGACGCGGCGGCTGCGGGG + Intergenic
1165626468 19:37281760-37281782 GCGGCGACGCGGCGGCTGCGGGG + Intergenic
1165627007 19:37284285-37284307 GCGGCGACGCGGCGGCTGCGGGG + Intergenic
1165627550 19:37286809-37286831 GCGGCGACGCGGCGGCTGCGGGG + Intergenic
1165628085 19:37289333-37289355 GCGGCGACGCGGCGGCTGCGGGG + Intergenic
1165628627 19:37291859-37291881 GCGGCGACGCGGCGGCTGCGGGG + Intergenic
1165629167 19:37294384-37294406 GCGGCGACGCGGCGGCTGCGGGG + Intergenic
1165629710 19:37296910-37296932 GCGGCGACGCGGCGGCTGCGGGG + Intergenic
1165630252 19:37299437-37299459 GCGGCGACGCGGCGGCTGCGGGG + Intergenic
1165630791 19:37301975-37301997 GCGGCGACGCGGCGGCTGCGGGG + Intergenic
1167019146 19:46861252-46861274 GCCGCCCCGCTGCGGGGTCCAGG + Intergenic
1167323550 19:48810953-48810975 GCAGCCCCGCGCCGGGGTCTGGG - Intronic
1202683545 1_KI270712v1_random:30238-30260 GCGGCACCGGGGCGGGTGGGGGG - Intergenic
927472133 2:23384990-23385012 GCTGCCGCGCGCCGGGTCCGAGG - Intergenic
929107162 2:38376850-38376872 GCAGCCACGCGGCGGGCTGGCGG + Intronic
931694266 2:64859987-64860009 GCGGCCCGGCGTCGGGTTACCGG + Intergenic
934248229 2:90324840-90324862 GCGGCACCGGGGCGGGTGGGGGG + Intergenic
935301714 2:101698318-101698340 GGGGTCGCGCGGCGGGCTCGGGG - Intronic
935963444 2:108449250-108449272 GCGGGCCGGCGGCGGGCTGGCGG + Exonic
936126691 2:109794568-109794590 GCCGCCCCCCGGCCGGGTCGAGG - Intronic
939629450 2:144516078-144516100 GCGGCCCCGCGCCGGGTGATCGG + Intronic
940009534 2:149038975-149038997 GCGGCGCAGTGGCGGGGTCGGGG + Intronic
945102565 2:206275138-206275160 GCGGCTCCGGGCCGGGATCGAGG + Intronic
948645595 2:239401729-239401751 CCTGCCCCGCGGCGGGAACGCGG + Intronic
948796201 2:240403093-240403115 GAGGCCCCGCGGAGGGTGAGTGG + Intergenic
948988716 2:241541258-241541280 GCGGGGCCGCGGCGGGGGCGGGG + Intergenic
1168802673 20:653298-653320 GCCGGACCGCGGCGGGGTCGGGG - Exonic
1169118645 20:3082894-3082916 GCGGGCCTGCGGCGGGGTGGGGG - Intronic
1169483441 20:6006218-6006240 GCGGCCGCGCCGCGGGGTCTCGG - Exonic
1172428571 20:34872684-34872706 GCGGCCCCTCAGCGGGGCCGCGG + Exonic
1175847594 20:62066480-62066502 GCTTCCCCGCGGCGGCTTGGAGG - Intergenic
1175994185 20:62805033-62805055 GCGGCCCCGCGGCGCGGAAGAGG + Intronic
1176548447 21:8211826-8211848 GCGGCGTCGCGGCGGGTCTGGGG + Intergenic
1176556339 21:8256032-8256054 GCGGCGTCGCGGCGGGTCTGGGG + Intergenic
1176567378 21:8394861-8394883 GCGGCGTCGCGGCGGGTCTGGGG + Intergenic
1176575278 21:8439074-8439096 GCGGCGTCGCGGCGGGTCTGGGG + Intergenic
1178561626 21:33643265-33643287 GCGGCCCCGCGGCGCGCCCTGGG - Intronic
1178610399 21:34074042-34074064 GCGGGCCGGCGCCGGGATCGGGG - Intronic
1184680606 22:46070747-46070769 GCAACCCCGCGGCGGCTTCCAGG - Intronic
1184766902 22:46576976-46576998 CCCGCCCCGCGGCCGGCTCGGGG - Intronic
1185345060 22:50307412-50307434 GCGGCTCCGCGGAGGGCTCCCGG - Intronic
1203253329 22_KI270733v1_random:128129-128151 GCGGCGTCGCGGCGGGTCTGGGG + Intergenic
1203261384 22_KI270733v1_random:173208-173230 GCGGCGTCGCGGCGGGTCTGGGG + Intergenic
950785114 3:15427790-15427812 GCGGTCCAGCAGCGGGTTTGCGG - Exonic
952788046 3:37175901-37175923 GCCGGCCCGCGGCGGGCTCCCGG - Intronic
961081560 3:124033035-124033057 GCGGCCCCGCGCCGGCCTCCCGG - Intergenic
968382414 4:107822-107844 GAGGCCCAGGGGCGGGTCCGCGG + Intergenic
968479255 4:826368-826390 GCGGACCCGGGGCGGGGGCGGGG + Intergenic
968649664 4:1755495-1755517 GCGGCCCCGAGGCGAGTGCTGGG - Intergenic
972960709 4:44448654-44448676 GCGGCCCCGCTCAGGGTTCGGGG + Exonic
976595608 4:86892354-86892376 GCGGCCCCGAGGCGTGTGCGCGG - Intronic
980355085 4:131727455-131727477 GCGGCGACGCGGCGGCTGCGGGG - Intergenic
980356708 4:131734921-131734943 GCGGCGACGCGGCGGCTGCGGGG - Intergenic
980357247 4:131737409-131737431 GCGGCGACGCGGCGGCTGCGGGG - Intergenic
980357790 4:131739904-131739926 GCGGCGACGCGGCGGCTGCGGGG - Intergenic
980358323 4:131742387-131742409 GCGGCGACGCGGCGGCTGCGGGG - Intergenic
980358860 4:131744884-131744906 GCGGCGACGCGGCGGCTGCGGGG - Intergenic
980359943 4:131749825-131749847 GCGGCGACGCGGCGGCTGCGGGG - Intergenic
980360482 4:131752320-131752342 GCGGCGACGCGGCGGCTGCGGGG - Intergenic
980361565 4:131757275-131757297 GCGGCGACGCGGCGGCTGCGGGG - Intergenic
982000315 4:151015791-151015813 GCAGCCGCGCGGCGGGGGCGCGG + Intergenic
982484769 4:155953737-155953759 GCGGCTCCGCGGCCAGGTCGGGG + Exonic
986608624 5:9546177-9546199 GCGGCGCGGCGGCGGGGGCGGGG - Intergenic
987258230 5:16179380-16179402 TTGGCCCCGCGGCGCGCTCGGGG + Exonic
989147009 5:38258805-38258827 GCGACACCGCGCCGGGTCCGAGG - Exonic
992052800 5:72956349-72956371 GCGGCCCCGCTGCGGGCCCCCGG - Intronic
1002323277 5:178388395-178388417 GCTGCCCCGCTGCAGGTTCCAGG - Intronic
1005928967 6:30466609-30466631 TCGGCGCCGCGGCGGGGTAGAGG - Intergenic
1019621624 7:1995290-1995312 GCAGCCCCGGGGCTGGTTCCAGG - Intronic
1019828126 7:3300931-3300953 GCGCTCCCGTGGCGGGCTCGCGG - Intergenic
1025940861 7:66075634-66075656 GCGGCCCCGGGGCGGGGAAGCGG - Intergenic
1029098418 7:98107285-98107307 GCGGGCCCGCGGCGGGGACGGGG + Intronic
1029271486 7:99379744-99379766 GCTGCCCAGCGGCGGGGTGGTGG - Intronic
1035689201 8:1548786-1548808 GCGGCCGCGCGTCGGGCCCGTGG - Exonic
1041690287 8:60680105-60680127 GCTGACCCCCGGCGGGTTGGGGG - Intronic
1049508997 8:143018470-143018492 GCGGCCCCGGGGCGGGGGCAGGG - Intronic
1049510704 8:143025422-143025444 GCGGTCCTGGGGCGGGTCCGAGG - Intergenic
1053643110 9:40106714-40106736 GCGGCGACGCGGCGGCTGCGGGG + Intergenic
1053763037 9:41358775-41358797 GCGGCGACGCGGCGGCTGCGGGG - Intergenic
1054323962 9:63703942-63703964 GCGGCAACGCGGCGGCTGCGGGG + Intergenic
1054541645 9:66269889-66269911 GCGGCGACGCGGCGGCTGCGGGG - Intergenic
1054731355 9:68705340-68705362 GCCTCGCCGCGGCGCGTTCGGGG - Intergenic
1057322957 9:94030992-94031014 GCTGCCCCGCGGAGGGTCTGTGG - Intronic
1057337433 9:94166612-94166634 CCGGCCCCGCGGCGGCCACGCGG - Intergenic
1060200940 9:121651564-121651586 CCGGCCCCGCGGCGGGGGCTGGG - Intronic
1061262626 9:129488530-129488552 GCGGCCGCGGGGCGGGGGCGGGG - Intergenic
1062341414 9:136095310-136095332 GCCGCACCGCGGCGGGGGCGGGG + Intergenic
1062349923 9:136133517-136133539 GCGGCCCCGCGGCCTGGGCGCGG + Intergenic
1062574635 9:137200489-137200511 GCGGCGGCGCGGCGGGGGCGCGG - Exonic
1203469729 Un_GL000220v1:111276-111298 GCGGCGTCGCGGCGGGTCTGGGG + Intergenic
1203477550 Un_GL000220v1:155248-155270 GCGGCGTCGCGGCGGGTCTGGGG + Intergenic
1187181385 X:16946701-16946723 GCGGCCGCGCGGCAGCTGCGGGG + Exonic
1190829012 X:54044040-54044062 GCGACCCAGCGGGGGGCTCGAGG - Intronic
1192369439 X:70501001-70501023 GCTGCCCTGCGGGGGGTTCTGGG + Intronic
1195278912 X:103310726-103310748 GCGGTCCCGCGGCGGGGCCCCGG + Exonic
1197753416 X:129980430-129980452 GCGGCCCTGCGGCGGGGGCGGGG + Intergenic