ID: 1129780099

View in Genome Browser
Species Human (GRCh38)
Location 15:78264453-78264475
Sequence GGCCGCCGGAACCTCCGCGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 4, 3: 8, 4: 65}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129780088_1129780099 18 Left 1129780088 15:78264412-78264434 CCGGACGGGCGTCGGGGGTCTGG 0: 1
1: 0
2: 0
3: 5
4: 90
Right 1129780099 15:78264453-78264475 GGCCGCCGGAACCTCCGCGAAGG 0: 1
1: 0
2: 4
3: 8
4: 65
1129780094_1129780099 -6 Left 1129780094 15:78264436-78264458 CCGCGAACCCGCCGCGGGGCCGC 0: 1
1: 0
2: 0
3: 12
4: 190
Right 1129780099 15:78264453-78264475 GGCCGCCGGAACCTCCGCGAAGG 0: 1
1: 0
2: 4
3: 8
4: 65
1129780086_1129780099 23 Left 1129780086 15:78264407-78264429 CCGCGCCGGACGGGCGTCGGGGG 0: 1
1: 0
2: 0
3: 8
4: 76
Right 1129780099 15:78264453-78264475 GGCCGCCGGAACCTCCGCGAAGG 0: 1
1: 0
2: 4
3: 8
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129780099 Original CRISPR GGCCGCCGGAACCTCCGCGA AGG Intronic
900283870 1:1890376-1890398 GGCGGCCGGAGCCCCCGCGCGGG - Intronic
903668285 1:25021212-25021234 GGCCGCAGGGACCTCAGGGAGGG + Intergenic
905762546 1:40572324-40572346 GGCCGCAGGAACCTCTGCCTAGG + Intergenic
906237204 1:44219239-44219261 GGCTGGCGGAACCTCCGCACCGG - Exonic
907053509 1:51345080-51345102 GGCCGCCGCCGCCGCCGCGAGGG - Exonic
910892270 1:92030218-92030240 GGCCGCCGGAAGGTCTGCGCCGG - Exonic
912993454 1:114510980-114511002 GGCCGCCGGGCCCGCCGCGCAGG - Exonic
914301494 1:146381447-146381469 GGCCGCAGGGACCTCTGCCAAGG + Intergenic
921934854 1:220786950-220786972 CGCCGCCGGCTCCTCCGCGCTGG + Exonic
1065636989 10:27743465-27743487 GGCCGCCGGGAGCTCCGCAGCGG + Exonic
1070290667 10:75111520-75111542 GGCCGCCGTCACCGCCGCGCCGG - Intronic
1074815410 10:117138220-117138242 GGCCGCCGAAGCCTCCCCGCGGG - Intronic
1076668240 10:132104858-132104880 GGCCGCCTGCAGCGCCGCGAGGG - Exonic
1077036660 11:498718-498740 CGCCGCCCGACCCTCCGGGAAGG + Intronic
1084642640 11:70434878-70434900 GGCAGCAGGAGCCTCCGCGGTGG + Intronic
1087795465 11:102451928-102451950 GGCCGCCTCAACTACCGCGAGGG + Intronic
1088250674 11:107858705-107858727 GGCCGCCGCTCCCTCCGCGAGGG + Exonic
1092455077 12:8635955-8635977 GGCCGCAGGGACCTCCGCCTAGG + Intergenic
1103626810 12:122226211-122226233 AACCGCCGGAACTTCCGCGCGGG + Exonic
1110782382 13:79481298-79481320 GGCCGCCGAGACCTCCGCGTTGG - Exonic
1113909265 13:113834503-113834525 GGCCCCCGGAACCACCGTGAAGG + Intronic
1117297435 14:54393038-54393060 GGCGGCCCGAGCCTCCCCGATGG - Intergenic
1121253086 14:92513911-92513933 TGCCGCCGGCAGCTCCGGGACGG - Exonic
1122445141 14:101762151-101762173 GGCCGCTGGGACCTTCGTGATGG + Intronic
1129780099 15:78264453-78264475 GGCCGCCGGAACCTCCGCGAAGG + Intronic
1133223124 16:4327747-4327769 GGCCGCGGGGACCACCGGGACGG - Intronic
1134034600 16:11020236-11020258 GGCCGCCAGCACCTCCGTGCAGG + Exonic
1145303654 17:21657287-21657309 GGCCGCCTGAACCTCCGCCAGGG + Intergenic
1145346390 17:22044562-22044584 GGCCGCCTGAACCTCCGCCAGGG - Intergenic
1148432022 17:47650226-47650248 CGCCGCCGCCACCTCCGCCATGG + Exonic
1149347236 17:55751112-55751134 GGCCGCCGGAAGCTTCTCGGAGG + Exonic
1151763681 17:76121641-76121663 CGCAGCTGGAACCTCCGAGAAGG + Intergenic
1152748332 17:82051403-82051425 GGCCCCCGGAGGCTCCGCGCGGG - Intronic
1152777591 17:82212590-82212612 CCCCGCCGCAGCCTCCGCGAGGG + Intronic
1153911251 18:9708249-9708271 GGCCGCCGGCCCCGCCGCGGTGG - Exonic
1161068753 19:2250354-2250376 GGCTCCTGGAACCTCAGCGAGGG - Exonic
1163462694 19:17448459-17448481 GCCCGCAGGAACCCCCGCCATGG - Exonic
1163698262 19:18774791-18774813 GGCCCCTGGAACCTCCCAGACGG - Intronic
1167893178 19:52558994-52559016 GGCCGCAGGAACCTCTGCCTAGG + Intronic
926801807 2:16665840-16665862 GGCCGCCGCAGCCTGCGAGACGG + Intronic
929208084 2:39321459-39321481 GGCCGCAGGGACCTCCGCCTAGG + Intronic
932355840 2:71068025-71068047 GGCTGCCGGGACCGCCTCGAGGG + Intronic
933868821 2:86548315-86548337 GGCCGCAGGAACCTCTGCCTAGG - Intronic
938270126 2:129962612-129962634 GGCCGCAGGAACCTCTGCCTAGG - Intergenic
1169044432 20:2524669-2524691 GGCCTCCAGATCCTCTGCGAAGG - Intronic
1171521174 20:25774972-25774994 GGCCGCCTGAACCTCCGCCAGGG + Exonic
1171555750 20:26081506-26081528 GGCCGCCTGAACCTCCGCCAGGG - Intergenic
1176655026 21:9580084-9580106 GGCCGCCTGAACCTCAGCCAGGG + Intergenic
1180082630 21:45493739-45493761 GGCCGGCGGAACCGCCGACATGG - Intronic
950442742 3:13019468-13019490 GGCCGCCGGCAGCTCCGCCTTGG + Intronic
950707589 3:14792697-14792719 GGCTGCTGGAACCTCTGAGATGG + Intergenic
953436424 3:42881089-42881111 GGCCCCCGAAGCCTCAGCGAGGG + Intronic
964356293 3:155854564-155854586 GGCTGCCGGAACCTTCGGGGAGG + Intergenic
972586208 4:40438830-40438852 GGCCGCCGGGTCCTCCGCCAAGG - Exonic
983834197 4:172369531-172369553 TGCAGCCTGAACCTCCCCGACGG - Intronic
983843139 4:172481944-172481966 GGCAGCCCGAGCCTCCCCGACGG - Intronic
999369879 5:151048221-151048243 TGCACCCTGAACCTCCGCGAGGG + Intronic
1000073978 5:157767667-157767689 GGCAGCTGGAACCTCTGGGACGG + Intergenic
1004693282 6:18011290-18011312 TGCCGCCGGAGCCTCCCCAACGG - Intergenic
1013793701 6:113860467-113860489 GGCCGCGGGCTCCTCCGCGGGGG - Exonic
1021845338 7:24757558-24757580 GGCCGCCGGAGGCTGCGGGAGGG + Intronic
1025281653 7:57629915-57629937 GACCGCCTGAACCTCCGCCAGGG + Intergenic
1025303077 7:57835600-57835622 GACCGCCTGAACCTCCGCCAGGG - Intergenic
1035265588 7:157688965-157688987 GGCCGCAGCACCCTCCGCGCCGG - Intronic
1035355256 7:158272794-158272816 TGCCGGCGGCACCTCCCCGATGG - Intronic
1035680231 8:1482662-1482684 GGCCGTGGGAACCACCGCGCAGG - Intergenic
1038632922 8:29262890-29262912 GGCCGCCGGACCCCCCACGGCGG + Intronic
1040501441 8:48008628-48008650 GGCCGCCGGGGCCTCGGCGCCGG - Intronic
1040701828 8:50075166-50075188 GGCAGCCGGAGCCTCCCCAATGG + Intronic
1048938515 8:139376821-139376843 CTCCGCCGGAACATCCCCGATGG + Intergenic
1058508851 9:105694551-105694573 GGCCGCCCGCTCCTCCGCGCCGG - Exonic
1061072990 9:128323101-128323123 GGCCGCCGGCTCCGCGGCGATGG + Exonic
1203632751 Un_KI270750v1:83537-83559 GGCCGCCTGAACCTCAGCCAGGG + Intergenic
1185892792 X:3835584-3835606 GGCCGCCGCATCCGCCGCGGCGG + Intronic
1185897900 X:3874004-3874026 GGCCGCCGCATCCGCCGCGGCGG + Intergenic
1185903019 X:3912435-3912457 GGCCGCCGCATCCGCCGCGGCGG + Intergenic
1199772571 X:150983977-150983999 GGCCACCGGGCGCTCCGCGACGG - Intronic
1202029096 Y:20553122-20553144 GGCCGCAGGAACCTCTGCCTAGG + Intergenic