ID: 1129780170

View in Genome Browser
Species Human (GRCh38)
Location 15:78264697-78264719
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 196}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129780170_1129780175 -7 Left 1129780170 15:78264697-78264719 CCAGGGTGCCGGCAGGGGCGTCC 0: 1
1: 0
2: 0
3: 15
4: 196
Right 1129780175 15:78264713-78264735 GGCGTCCGGGGCGCTCTGACCGG 0: 1
1: 0
2: 0
3: 3
4: 68
1129780170_1129780182 25 Left 1129780170 15:78264697-78264719 CCAGGGTGCCGGCAGGGGCGTCC 0: 1
1: 0
2: 0
3: 15
4: 196
Right 1129780182 15:78264745-78264767 CCCCCCCCGCAGACACAAGATGG 0: 1
1: 0
2: 1
3: 9
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129780170 Original CRISPR GGACGCCCCTGCCGGCACCC TGG (reversed) Intronic