ID: 1129780174 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 15:78264705-78264727 |
| Sequence | AGCGCCCCGGACGCCCCTGC CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 145 | |||
| Summary | {0: 1, 1: 0, 2: 2, 3: 5, 4: 137} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1129780174_1129780189 | 23 | Left | 1129780174 | 15:78264705-78264727 | CCGGCAGGGGCGTCCGGGGCGCT | 0: 1 1: 0 2: 2 3: 5 4: 137 |
||
| Right | 1129780189 | 15:78264751-78264773 | CCGCAGACACAAGATGGTGAAGG | 0: 1 1: 0 2: 0 3: 10 4: 106 |
||||
| 1129780174_1129780182 | 17 | Left | 1129780174 | 15:78264705-78264727 | CCGGCAGGGGCGTCCGGGGCGCT | 0: 1 1: 0 2: 2 3: 5 4: 137 |
||
| Right | 1129780182 | 15:78264745-78264767 | CCCCCCCCGCAGACACAAGATGG | 0: 1 1: 0 2: 1 3: 9 4: 102 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1129780174 | Original CRISPR | AGCGCCCCGGACGCCCCTGC CGG (reversed) | Intronic | ||