ID: 1129780174

View in Genome Browser
Species Human (GRCh38)
Location 15:78264705-78264727
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 137}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129780174_1129780189 23 Left 1129780174 15:78264705-78264727 CCGGCAGGGGCGTCCGGGGCGCT 0: 1
1: 0
2: 2
3: 5
4: 137
Right 1129780189 15:78264751-78264773 CCGCAGACACAAGATGGTGAAGG 0: 1
1: 0
2: 0
3: 10
4: 106
1129780174_1129780182 17 Left 1129780174 15:78264705-78264727 CCGGCAGGGGCGTCCGGGGCGCT 0: 1
1: 0
2: 2
3: 5
4: 137
Right 1129780182 15:78264745-78264767 CCCCCCCCGCAGACACAAGATGG 0: 1
1: 0
2: 1
3: 9
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129780174 Original CRISPR AGCGCCCCGGACGCCCCTGC CGG (reversed) Intronic