ID: 1129780176

View in Genome Browser
Species Human (GRCh38)
Location 15:78264718-78264740
Sequence CGAGGCCGGTCAGAGCGCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 90}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129780176_1129780182 4 Left 1129780176 15:78264718-78264740 CCGGGGCGCTCTGACCGGCCTCG 0: 1
1: 0
2: 0
3: 4
4: 90
Right 1129780182 15:78264745-78264767 CCCCCCCCGCAGACACAAGATGG 0: 1
1: 0
2: 1
3: 9
4: 102
1129780176_1129780189 10 Left 1129780176 15:78264718-78264740 CCGGGGCGCTCTGACCGGCCTCG 0: 1
1: 0
2: 0
3: 4
4: 90
Right 1129780189 15:78264751-78264773 CCGCAGACACAAGATGGTGAAGG 0: 1
1: 0
2: 0
3: 10
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129780176 Original CRISPR CGAGGCCGGTCAGAGCGCCC CGG (reversed) Intronic