ID: 1129780177

View in Genome Browser
Species Human (GRCh38)
Location 15:78264732-78264754
Sequence GCGGGGGGGGCGGGCGAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2642
Summary {0: 1, 1: 0, 2: 22, 3: 300, 4: 2319}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129780177_1129780190 20 Left 1129780177 15:78264732-78264754 CCGGCCTCGCCCGCCCCCCCCGC 0: 1
1: 0
2: 22
3: 300
4: 2319
Right 1129780190 15:78264775-78264797 GACCCAGTACTATGACATCCTGG 0: 1
1: 0
2: 0
3: 4
4: 77
1129780177_1129780191 21 Left 1129780177 15:78264732-78264754 CCGGCCTCGCCCGCCCCCCCCGC 0: 1
1: 0
2: 22
3: 300
4: 2319
Right 1129780191 15:78264776-78264798 ACCCAGTACTATGACATCCTGGG 0: 1
1: 0
2: 0
3: 2
4: 81
1129780177_1129780182 -10 Left 1129780177 15:78264732-78264754 CCGGCCTCGCCCGCCCCCCCCGC 0: 1
1: 0
2: 22
3: 300
4: 2319
Right 1129780182 15:78264745-78264767 CCCCCCCCGCAGACACAAGATGG 0: 1
1: 0
2: 1
3: 9
4: 102
1129780177_1129780189 -4 Left 1129780177 15:78264732-78264754 CCGGCCTCGCCCGCCCCCCCCGC 0: 1
1: 0
2: 22
3: 300
4: 2319
Right 1129780189 15:78264751-78264773 CCGCAGACACAAGATGGTGAAGG 0: 1
1: 0
2: 0
3: 10
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129780177 Original CRISPR GCGGGGGGGGCGGGCGAGGC CGG (reversed) Intronic