ID: 1129780178

View in Genome Browser
Species Human (GRCh38)
Location 15:78264736-78264758
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1215
Summary {0: 1, 1: 0, 2: 2, 3: 110, 4: 1102}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129780178_1129780190 16 Left 1129780178 15:78264736-78264758 CCTCGCCCGCCCCCCCCGCAGAC 0: 1
1: 0
2: 2
3: 110
4: 1102
Right 1129780190 15:78264775-78264797 GACCCAGTACTATGACATCCTGG 0: 1
1: 0
2: 0
3: 4
4: 77
1129780178_1129780189 -8 Left 1129780178 15:78264736-78264758 CCTCGCCCGCCCCCCCCGCAGAC 0: 1
1: 0
2: 2
3: 110
4: 1102
Right 1129780189 15:78264751-78264773 CCGCAGACACAAGATGGTGAAGG 0: 1
1: 0
2: 0
3: 10
4: 106
1129780178_1129780191 17 Left 1129780178 15:78264736-78264758 CCTCGCCCGCCCCCCCCGCAGAC 0: 1
1: 0
2: 2
3: 110
4: 1102
Right 1129780191 15:78264776-78264798 ACCCAGTACTATGACATCCTGGG 0: 1
1: 0
2: 0
3: 2
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129780178 Original CRISPR GTCTGCGGGGGGGGCGGGCG AGG (reversed) Exonic