ID: 1129780180 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 15:78264742-78264764 |
| Sequence | TCTTGTGTCTGCGGGGGGGG CGG (reversed) |
| Strand | - |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 455 | |||
| Summary | {0: 1, 1: 0, 2: 3, 3: 34, 4: 417} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1129780180_1129780190 | 10 | Left | 1129780180 | 15:78264742-78264764 | CCGCCCCCCCCGCAGACACAAGA | 0: 1 1: 0 2: 3 3: 34 4: 417 |
||
| Right | 1129780190 | 15:78264775-78264797 | GACCCAGTACTATGACATCCTGG | 0: 1 1: 0 2: 0 3: 4 4: 77 |
||||
| 1129780180_1129780191 | 11 | Left | 1129780180 | 15:78264742-78264764 | CCGCCCCCCCCGCAGACACAAGA | 0: 1 1: 0 2: 3 3: 34 4: 417 |
||
| Right | 1129780191 | 15:78264776-78264798 | ACCCAGTACTATGACATCCTGGG | 0: 1 1: 0 2: 0 3: 2 4: 81 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1129780180 | Original CRISPR | TCTTGTGTCTGCGGGGGGGG CGG (reversed) | Exonic | ||