ID: 1129780182

View in Genome Browser
Species Human (GRCh38)
Location 15:78264745-78264767
Sequence CCCCCCCCGCAGACACAAGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 102}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129780176_1129780182 4 Left 1129780176 15:78264718-78264740 CCGGGGCGCTCTGACCGGCCTCG 0: 1
1: 0
2: 0
3: 4
4: 90
Right 1129780182 15:78264745-78264767 CCCCCCCCGCAGACACAAGATGG 0: 1
1: 0
2: 1
3: 9
4: 102
1129780177_1129780182 -10 Left 1129780177 15:78264732-78264754 CCGGCCTCGCCCGCCCCCCCCGC 0: 1
1: 0
2: 22
3: 300
4: 2319
Right 1129780182 15:78264745-78264767 CCCCCCCCGCAGACACAAGATGG 0: 1
1: 0
2: 1
3: 9
4: 102
1129780170_1129780182 25 Left 1129780170 15:78264697-78264719 CCAGGGTGCCGGCAGGGGCGTCC 0: 1
1: 0
2: 0
3: 15
4: 196
Right 1129780182 15:78264745-78264767 CCCCCCCCGCAGACACAAGATGG 0: 1
1: 0
2: 1
3: 9
4: 102
1129780174_1129780182 17 Left 1129780174 15:78264705-78264727 CCGGCAGGGGCGTCCGGGGCGCT 0: 1
1: 0
2: 2
3: 5
4: 137
Right 1129780182 15:78264745-78264767 CCCCCCCCGCAGACACAAGATGG 0: 1
1: 0
2: 1
3: 9
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129780182 Original CRISPR CCCCCCCCGCAGACACAAGA TGG Exonic