ID: 1129780184

View in Genome Browser
Species Human (GRCh38)
Location 15:78264747-78264769
Sequence CACCATCTTGTGTCTGCGGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 93}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129780184_1129780195 29 Left 1129780184 15:78264747-78264769 CCCCCCGCAGACACAAGATGGTG 0: 1
1: 0
2: 0
3: 11
4: 93
Right 1129780195 15:78264799-78264821 CGTGAAGCCCAGCGCGTCCCCGG 0: 1
1: 0
2: 0
3: 4
4: 98
1129780184_1129780190 5 Left 1129780184 15:78264747-78264769 CCCCCCGCAGACACAAGATGGTG 0: 1
1: 0
2: 0
3: 11
4: 93
Right 1129780190 15:78264775-78264797 GACCCAGTACTATGACATCCTGG 0: 1
1: 0
2: 0
3: 4
4: 77
1129780184_1129780191 6 Left 1129780184 15:78264747-78264769 CCCCCCGCAGACACAAGATGGTG 0: 1
1: 0
2: 0
3: 11
4: 93
Right 1129780191 15:78264776-78264798 ACCCAGTACTATGACATCCTGGG 0: 1
1: 0
2: 0
3: 2
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129780184 Original CRISPR CACCATCTTGTGTCTGCGGG GGG (reversed) Exonic