ID: 1129780187

View in Genome Browser
Species Human (GRCh38)
Location 15:78264750-78264772
Sequence CTTCACCATCTTGTGTCTGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 252}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129780187_1129780190 2 Left 1129780187 15:78264750-78264772 CCCGCAGACACAAGATGGTGAAG 0: 1
1: 0
2: 1
3: 17
4: 252
Right 1129780190 15:78264775-78264797 GACCCAGTACTATGACATCCTGG 0: 1
1: 0
2: 0
3: 4
4: 77
1129780187_1129780191 3 Left 1129780187 15:78264750-78264772 CCCGCAGACACAAGATGGTGAAG 0: 1
1: 0
2: 1
3: 17
4: 252
Right 1129780191 15:78264776-78264798 ACCCAGTACTATGACATCCTGGG 0: 1
1: 0
2: 0
3: 2
4: 81
1129780187_1129780196 29 Left 1129780187 15:78264750-78264772 CCCGCAGACACAAGATGGTGAAG 0: 1
1: 0
2: 1
3: 17
4: 252
Right 1129780196 15:78264802-78264824 GAAGCCCAGCGCGTCCCCGGAGG 0: 1
1: 0
2: 0
3: 9
4: 107
1129780187_1129780195 26 Left 1129780187 15:78264750-78264772 CCCGCAGACACAAGATGGTGAAG 0: 1
1: 0
2: 1
3: 17
4: 252
Right 1129780195 15:78264799-78264821 CGTGAAGCCCAGCGCGTCCCCGG 0: 1
1: 0
2: 0
3: 4
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129780187 Original CRISPR CTTCACCATCTTGTGTCTGC GGG (reversed) Exonic