ID: 1129780188

View in Genome Browser
Species Human (GRCh38)
Location 15:78264751-78264773
Sequence CCTTCACCATCTTGTGTCTG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 205}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129780188_1129780196 28 Left 1129780188 15:78264751-78264773 CCGCAGACACAAGATGGTGAAGG 0: 1
1: 0
2: 2
3: 15
4: 205
Right 1129780196 15:78264802-78264824 GAAGCCCAGCGCGTCCCCGGAGG 0: 1
1: 0
2: 0
3: 9
4: 107
1129780188_1129780195 25 Left 1129780188 15:78264751-78264773 CCGCAGACACAAGATGGTGAAGG 0: 1
1: 0
2: 2
3: 15
4: 205
Right 1129780195 15:78264799-78264821 CGTGAAGCCCAGCGCGTCCCCGG 0: 1
1: 0
2: 0
3: 4
4: 98
1129780188_1129780191 2 Left 1129780188 15:78264751-78264773 CCGCAGACACAAGATGGTGAAGG 0: 1
1: 0
2: 2
3: 15
4: 205
Right 1129780191 15:78264776-78264798 ACCCAGTACTATGACATCCTGGG 0: 1
1: 0
2: 0
3: 2
4: 81
1129780188_1129780190 1 Left 1129780188 15:78264751-78264773 CCGCAGACACAAGATGGTGAAGG 0: 1
1: 0
2: 2
3: 15
4: 205
Right 1129780190 15:78264775-78264797 GACCCAGTACTATGACATCCTGG 0: 1
1: 0
2: 0
3: 4
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129780188 Original CRISPR CCTTCACCATCTTGTGTCTG CGG (reversed) Exonic