ID: 1129780189

View in Genome Browser
Species Human (GRCh38)
Location 15:78264751-78264773
Sequence CCGCAGACACAAGATGGTGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 106}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129780174_1129780189 23 Left 1129780174 15:78264705-78264727 CCGGCAGGGGCGTCCGGGGCGCT 0: 1
1: 0
2: 2
3: 5
4: 137
Right 1129780189 15:78264751-78264773 CCGCAGACACAAGATGGTGAAGG 0: 1
1: 0
2: 0
3: 10
4: 106
1129780178_1129780189 -8 Left 1129780178 15:78264736-78264758 CCTCGCCCGCCCCCCCCGCAGAC 0: 1
1: 0
2: 2
3: 110
4: 1102
Right 1129780189 15:78264751-78264773 CCGCAGACACAAGATGGTGAAGG 0: 1
1: 0
2: 0
3: 10
4: 106
1129780177_1129780189 -4 Left 1129780177 15:78264732-78264754 CCGGCCTCGCCCGCCCCCCCCGC 0: 1
1: 0
2: 22
3: 300
4: 2319
Right 1129780189 15:78264751-78264773 CCGCAGACACAAGATGGTGAAGG 0: 1
1: 0
2: 0
3: 10
4: 106
1129780176_1129780189 10 Left 1129780176 15:78264718-78264740 CCGGGGCGCTCTGACCGGCCTCG 0: 1
1: 0
2: 0
3: 4
4: 90
Right 1129780189 15:78264751-78264773 CCGCAGACACAAGATGGTGAAGG 0: 1
1: 0
2: 0
3: 10
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129780189 Original CRISPR CCGCAGACACAAGATGGTGA AGG Exonic