ID: 1129780190

View in Genome Browser
Species Human (GRCh38)
Location 15:78264775-78264797
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 77}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129780178_1129780190 16 Left 1129780178 15:78264736-78264758 CCTCGCCCGCCCCCCCCGCAGAC 0: 1
1: 0
2: 2
3: 110
4: 1102
Right 1129780190 15:78264775-78264797 GACCCAGTACTATGACATCCTGG 0: 1
1: 0
2: 0
3: 4
4: 77
1129780186_1129780190 3 Left 1129780186 15:78264749-78264771 CCCCGCAGACACAAGATGGTGAA 0: 1
1: 0
2: 0
3: 8
4: 103
Right 1129780190 15:78264775-78264797 GACCCAGTACTATGACATCCTGG 0: 1
1: 0
2: 0
3: 4
4: 77
1129780183_1129780190 6 Left 1129780183 15:78264746-78264768 CCCCCCCGCAGACACAAGATGGT 0: 1
1: 0
2: 0
3: 10
4: 78
Right 1129780190 15:78264775-78264797 GACCCAGTACTATGACATCCTGG 0: 1
1: 0
2: 0
3: 4
4: 77
1129780179_1129780190 11 Left 1129780179 15:78264741-78264763 CCCGCCCCCCCCGCAGACACAAG 0: 1
1: 0
2: 0
3: 30
4: 314
Right 1129780190 15:78264775-78264797 GACCCAGTACTATGACATCCTGG 0: 1
1: 0
2: 0
3: 4
4: 77
1129780185_1129780190 4 Left 1129780185 15:78264748-78264770 CCCCCGCAGACACAAGATGGTGA 0: 1
1: 0
2: 0
3: 6
4: 75
Right 1129780190 15:78264775-78264797 GACCCAGTACTATGACATCCTGG 0: 1
1: 0
2: 0
3: 4
4: 77
1129780184_1129780190 5 Left 1129780184 15:78264747-78264769 CCCCCCGCAGACACAAGATGGTG 0: 1
1: 0
2: 0
3: 11
4: 93
Right 1129780190 15:78264775-78264797 GACCCAGTACTATGACATCCTGG 0: 1
1: 0
2: 0
3: 4
4: 77
1129780181_1129780190 7 Left 1129780181 15:78264745-78264767 CCCCCCCCGCAGACACAAGATGG 0: 1
1: 0
2: 0
3: 8
4: 112
Right 1129780190 15:78264775-78264797 GACCCAGTACTATGACATCCTGG 0: 1
1: 0
2: 0
3: 4
4: 77
1129780180_1129780190 10 Left 1129780180 15:78264742-78264764 CCGCCCCCCCCGCAGACACAAGA 0: 1
1: 0
2: 3
3: 34
4: 417
Right 1129780190 15:78264775-78264797 GACCCAGTACTATGACATCCTGG 0: 1
1: 0
2: 0
3: 4
4: 77
1129780188_1129780190 1 Left 1129780188 15:78264751-78264773 CCGCAGACACAAGATGGTGAAGG 0: 1
1: 0
2: 2
3: 15
4: 205
Right 1129780190 15:78264775-78264797 GACCCAGTACTATGACATCCTGG 0: 1
1: 0
2: 0
3: 4
4: 77
1129780187_1129780190 2 Left 1129780187 15:78264750-78264772 CCCGCAGACACAAGATGGTGAAG 0: 1
1: 0
2: 1
3: 17
4: 252
Right 1129780190 15:78264775-78264797 GACCCAGTACTATGACATCCTGG 0: 1
1: 0
2: 0
3: 4
4: 77
1129780177_1129780190 20 Left 1129780177 15:78264732-78264754 CCGGCCTCGCCCGCCCCCCCCGC 0: 1
1: 0
2: 22
3: 300
4: 2319
Right 1129780190 15:78264775-78264797 GACCCAGTACTATGACATCCTGG 0: 1
1: 0
2: 0
3: 4
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type