ID: 1129785723

View in Genome Browser
Species Human (GRCh38)
Location 15:78308917-78308939
Sequence AGGTATGTGCAGAGGATGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129785723_1129785735 14 Left 1129785723 15:78308917-78308939 CCTCCCATCCTCTGCACATACCT No data
Right 1129785735 15:78308954-78308976 ATCCTGCGAGCATGGCCTGGGGG No data
1129785723_1129785734 13 Left 1129785723 15:78308917-78308939 CCTCCCATCCTCTGCACATACCT No data
Right 1129785734 15:78308953-78308975 CATCCTGCGAGCATGGCCTGGGG No data
1129785723_1129785731 6 Left 1129785723 15:78308917-78308939 CCTCCCATCCTCTGCACATACCT No data
Right 1129785731 15:78308946-78308968 GGGGCTGCATCCTGCGAGCATGG No data
1129785723_1129785732 11 Left 1129785723 15:78308917-78308939 CCTCCCATCCTCTGCACATACCT No data
Right 1129785732 15:78308951-78308973 TGCATCCTGCGAGCATGGCCTGG No data
1129785723_1129785733 12 Left 1129785723 15:78308917-78308939 CCTCCCATCCTCTGCACATACCT No data
Right 1129785733 15:78308952-78308974 GCATCCTGCGAGCATGGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129785723 Original CRISPR AGGTATGTGCAGAGGATGGG AGG (reversed) Intergenic
No off target data available for this crispr