ID: 1129796628

View in Genome Browser
Species Human (GRCh38)
Location 15:78382346-78382368
Sequence GGCTGCACACTCCGTGGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129796620_1129796628 12 Left 1129796620 15:78382311-78382333 CCATCATGCGGGCTGCAGCAGGG No data
Right 1129796628 15:78382346-78382368 GGCTGCACACTCCGTGGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129796628 Original CRISPR GGCTGCACACTCCGTGGAGC TGG Intergenic
No off target data available for this crispr