ID: 1129798379

View in Genome Browser
Species Human (GRCh38)
Location 15:78395258-78395280
Sequence ATTAACAAGGGGAAGATGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129798366_1129798379 24 Left 1129798366 15:78395211-78395233 CCAGAGGATGAGACCGCGGCTCT No data
Right 1129798379 15:78395258-78395280 ATTAACAAGGGGAAGATGGGAGG No data
1129798368_1129798379 11 Left 1129798368 15:78395224-78395246 CCGCGGCTCTAAAGGAGACTCCA No data
Right 1129798379 15:78395258-78395280 ATTAACAAGGGGAAGATGGGAGG No data
1129798371_1129798379 -9 Left 1129798371 15:78395244-78395266 CCACCAGGGCCAACATTAACAAG No data
Right 1129798379 15:78395258-78395280 ATTAACAAGGGGAAGATGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129798379 Original CRISPR ATTAACAAGGGGAAGATGGG AGG Intergenic
No off target data available for this crispr