ID: 1129804774

View in Genome Browser
Species Human (GRCh38)
Location 15:78446653-78446675
Sequence ACAGAGAGACTGAACTGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 447
Summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 404}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129804774_1129804777 2 Left 1129804774 15:78446653-78446675 CCTTTCCAGTTCAGTCTCTCTGT 0: 1
1: 0
2: 2
3: 40
4: 404
Right 1129804777 15:78446678-78446700 CCTGATTACACATTTCTGAGAGG 0: 1
1: 0
2: 1
3: 15
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129804774 Original CRISPR ACAGAGAGACTGAACTGGAA AGG (reversed) Intronic
904195192 1:28780307-28780329 GAAGAGAGCCTGAACTGGAGTGG - Intergenic
904329805 1:29751201-29751223 ACCCAGAGACAGGACTGGAAAGG + Intergenic
906022976 1:42647219-42647241 ACACAGAGACTGAAAAGGAGTGG + Intronic
906474425 1:46158701-46158723 TCAGAGAAACAGAACTGGGATGG + Intronic
906764148 1:48411104-48411126 ACAGAGAGACAGAGATGGGATGG + Intronic
906775070 1:48521750-48521772 ACAGAGAGAAAAAACAGGAAGGG - Intergenic
906876012 1:49540184-49540206 AAAGAGAGAATAATCTGGAAAGG - Intronic
906876374 1:49543125-49543147 AGAGAGGGACAGAACTGGCAAGG - Intronic
906903266 1:49861245-49861267 CCAGAGACATTGGACTGGAAGGG + Intronic
907395288 1:54185456-54185478 ACTGGGAGACAGGACTGGAAGGG + Intronic
907789097 1:57644227-57644249 CTAGACAGAATGAACTGGAATGG + Intronic
908092004 1:60696200-60696222 ACAAAGAGATTGAAATGAAATGG + Intergenic
908384416 1:63627515-63627537 AGAAAGAGCCTGATCTGGAAGGG + Intronic
908430208 1:64049577-64049599 ACAGAGAGGCTGAGCAGGAGAGG - Intronic
909914178 1:81297283-81297305 ACAGAAAGCATGAACTGTAAAGG + Intergenic
910340310 1:86179675-86179697 TCATAGAGACAGAAGTGGAATGG - Intergenic
912227478 1:107751461-107751483 AAAGAAAGACTCAACCGGAAGGG + Intronic
912807341 1:112767616-112767638 ACAGAGTGGCTGAAGTGCAATGG - Intergenic
912905375 1:113699957-113699979 AGAGGGAGACTGATCAGGAATGG - Intronic
912935102 1:113996430-113996452 ACAGAGAGACTGAAAGTGAAGGG + Intergenic
914387260 1:147181894-147181916 CCAGAGTGAATGAACTGAAAAGG + Intronic
914794212 1:150906318-150906340 ACAAAAAGAATGAACTGGGAGGG + Intergenic
916015992 1:160750357-160750379 ACAAAGAGACTGAGCAGGAGGGG - Exonic
916660618 1:166920097-166920119 AAAGAGACAATGAACTGGATAGG + Intronic
916831472 1:168496395-168496417 AGAGAAAGACTGAACTGGCAAGG + Intergenic
918434275 1:184495342-184495364 AAAGATAAACTGAACTGGGATGG - Intronic
919020788 1:192102420-192102442 ACCGATTGACTGAACTTGAATGG + Intergenic
919271979 1:195360084-195360106 CCAGAGACAGTGAACTGGGAGGG + Intergenic
920024883 1:202987047-202987069 ACAGAGGGACTGAAATGAATAGG + Intergenic
920269592 1:204752726-204752748 ACAGAGAGACGGATATGGGATGG + Intergenic
920280974 1:204843538-204843560 AGAGAGAGACAGACCTGGAGAGG - Intronic
921123054 1:212153298-212153320 GAAGAGAGAATGAACTGGTATGG + Intergenic
921252094 1:213307762-213307784 ACAGTGAAACTCAAGTGGAATGG + Intergenic
921839607 1:219814685-219814707 ACAGAGGGACTGGGCTGTAATGG - Intronic
922617146 1:226967593-226967615 AGACAGAGACTGATGTGGAAGGG + Intronic
923083268 1:230680522-230680544 TGAGAGAAACTGAAATGGAAGGG - Intronic
923639135 1:235735207-235735229 ACAGAAAAACTGAACTAGAAGGG + Intronic
923664098 1:235983425-235983447 ACAGTGAGACTGACCTCCAAAGG + Intronic
924225886 1:241921321-241921343 ACAGAGGGCCTGATATGGAATGG + Intergenic
924370767 1:243347960-243347982 AGAGAGAGACTGAAGAAGAAAGG - Intronic
924645968 1:245877580-245877602 AGAGAGAGACTGAAGAGAAAAGG + Intronic
924842917 1:247733139-247733161 ACAGAAATAATAAACTGGAAGGG - Intergenic
1062888336 10:1036551-1036573 ACACAGAGTCTGAAGAGGAAAGG - Intergenic
1063439077 10:6057494-6057516 ATAGAGTGAAGGAACTGGAAGGG + Intronic
1064125991 10:12660589-12660611 GCAGAGAGAGTCAACTTGAATGG - Intronic
1064334327 10:14425054-14425076 ACTGAAAGCCTGAATTGGAAAGG + Intronic
1064754982 10:18565456-18565478 GAATGGAGACTGAACTGGAATGG - Intronic
1065731480 10:28713406-28713428 CCAGACAGCCTGTACTGGAAGGG + Intergenic
1066556642 10:36621762-36621784 AAACAGAAACTGAACTGTAAGGG + Intergenic
1066776186 10:38888354-38888376 ACGAATAGAATGAACTGGAATGG + Intergenic
1067808776 10:49410945-49410967 ACCGAGAGACTGTCCTTGAATGG + Intergenic
1068069481 10:52178858-52178880 ACACACAGACTGAAAAGGAAGGG - Intronic
1068564721 10:58561411-58561433 ACACACAGACTGAACATGAAGGG - Intronic
1068842204 10:61628111-61628133 ACAGAGAGACAGAAGGGAAATGG + Intergenic
1069784564 10:70979468-70979490 ACAGAGACAGTGAGCTGGCATGG - Intergenic
1070230796 10:74564923-74564945 ACAGAGCCACTGAACTATAAGGG - Intronic
1070584988 10:77757598-77757620 ACACACAGACTGAAACGGAAGGG + Intergenic
1070669835 10:78370014-78370036 ACAGAGAGAACGGACAGGAAAGG + Intergenic
1070748093 10:78947259-78947281 ACGGAGAGTCAGACCTGGAAAGG - Intergenic
1071510648 10:86260541-86260563 GCAGACAGACACAACTGGAATGG + Intronic
1071553517 10:86585296-86585318 AGAGACAGCCTGAACTAGAATGG + Intergenic
1072127527 10:92460431-92460453 ACAGAGAGAAGAAACTGAAAGGG + Intronic
1075563212 10:123483327-123483349 ACAGGGTGTCTGCACTGGAAAGG + Intergenic
1078358433 11:10649822-10649844 ACAGGGAGACTGAACTTGTGGGG - Intronic
1079493052 11:21010891-21010913 AGAGACAGACTGAACAGAAAGGG - Intronic
1080879180 11:36303074-36303096 ACAGAGAGACTAAACTCAAGAGG - Intronic
1081739506 11:45428337-45428359 CCACAGAAACTGAACTGGCAGGG - Intergenic
1082642357 11:55678966-55678988 ACAGAGAGAAAACACTGGAAAGG + Intergenic
1083254705 11:61489016-61489038 ACAGAGAGTCTGAGCTGGAAGGG + Intronic
1085576747 11:77611941-77611963 CTAGAGAGACTGAGCTGAAAAGG - Intronic
1085818210 11:79763934-79763956 ACAGGGAGACTGGATTGCAAGGG + Intergenic
1085876544 11:80413778-80413800 AGTGAGAGAATGAATTGGAAAGG + Intergenic
1086434329 11:86766324-86766346 ACAGACAGACAGAGTTGGAACGG + Intergenic
1087131048 11:94669526-94669548 ACAGGGACACAGAGCTGGAAGGG + Intergenic
1087272390 11:96124712-96124734 AGAGAGAGACTGCACATGAACGG + Intronic
1087702702 11:101453538-101453560 ACAGGGAGAGTGAACTTCAAGGG - Intronic
1087876873 11:103369430-103369452 CCAGAGACAGTGAACTGGAAGGG + Intronic
1089149550 11:116354212-116354234 GCAGAGGGAATGAACTGGATCGG + Intergenic
1089301149 11:117499348-117499370 ACAGCTAGTCTGAGCTGGAAGGG + Intronic
1090046943 11:123344032-123344054 AGAGAGAGACTGAGCTGTTAGGG - Intergenic
1090249975 11:125244415-125244437 ACCAAGAGACAGATCTGGAAGGG - Intronic
1090541650 11:127712515-127712537 CCAGAGTGAGTGAGCTGGAAAGG - Intergenic
1090676660 11:129004733-129004755 ACACAGAGACTGAAAAGAAAGGG - Intronic
1090914406 11:131150551-131150573 AGAGAGAGACTTGACTGGAAAGG + Intergenic
1091387235 12:103178-103200 ACTGAGAGCCTGAAAGGGAAGGG - Intronic
1092306244 12:7304092-7304114 ACAGACAGAATGAAGAGGAAGGG + Intergenic
1092306558 12:7306780-7306802 ACAGAGAGACTGAAACTCAATGG + Intronic
1093794572 12:23296158-23296180 AGAGAAAGTCTGAATTGGAACGG - Intergenic
1094070585 12:26408572-26408594 ACAGAGAGAGAGAACTGCCAGGG - Intronic
1096176630 12:49525281-49525303 AAAGAGAGAGTGAACTGGTGGGG + Intronic
1097202092 12:57287841-57287863 ATTGAGAGACTGAAATGAAAGGG + Intronic
1097396585 12:59082491-59082513 AGTGAGAGACAGAACTGGAAAGG - Intergenic
1097477756 12:60079993-60080015 ACACATAGACTGAACGTGAAGGG + Intergenic
1100804651 12:98269168-98269190 ACACAGAGACTGAAAATGAAAGG + Intergenic
1101815103 12:108140233-108140255 ACTGAGATACAAAACTGGAAGGG + Intronic
1104083781 12:125456699-125456721 ACAGAGAGACTGCAGTGGGGAGG - Intronic
1104642643 12:130477319-130477341 ACACAGAGACTGTCCAGGAAGGG - Intronic
1105928126 13:25026491-25026513 ACAGACAGACAGAGATGGAAAGG - Intergenic
1105942767 13:25164591-25164613 ACAGACAGACAGAGATGGAAAGG + Intronic
1106001132 13:25724376-25724398 TCAGAGAGAGTGAACAGGCAGGG + Intronic
1106654234 13:31725345-31725367 AGAGTGAGAGTGAACTAGAAAGG + Intergenic
1107000143 13:35534539-35534561 GCAGAAAGGATGAACTGGAATGG - Intronic
1107215803 13:37917088-37917110 TCAGTCACACTGAACTGGAAAGG + Intergenic
1107509102 13:41063655-41063677 AAAGACAGACTACACTGGAAGGG - Intronic
1107850311 13:44565281-44565303 AAAGACAGACTGAAAAGGAATGG + Intronic
1108721948 13:53141250-53141272 ACAAAGAGAGTGAGATGGAAGGG - Intergenic
1109010886 13:56942617-56942639 CCAGAGAGACTGCAGTGGAGAGG + Intergenic
1109280458 13:60349650-60349672 ACAGACAGACAGACCTGGGACGG + Intergenic
1109432137 13:62249945-62249967 ACAGAGAAACTGAAATGCGATGG - Intergenic
1111625916 13:90786511-90786533 ACACAGAGACTGAAAGTGAAGGG - Intergenic
1112873709 13:104008085-104008107 ACAGAGAAAAAGAACAGGAAAGG - Intergenic
1115708377 14:36022261-36022283 ACAGAGAGTCTCAACTGGGATGG + Intergenic
1115709493 14:36034736-36034758 ACACATAGACTGAAATTGAAGGG - Intergenic
1116029707 14:39555997-39556019 AGAGAGAGACTCAATTGGCAGGG - Intergenic
1116346349 14:43799869-43799891 TAAGAGAGAATGAACTGGTAGGG - Intergenic
1118681072 14:68242100-68242122 AGTGAGAGACAGATCTGGAAAGG - Intronic
1119145365 14:72308794-72308816 ATAGAGAGAATGAGCTAGAAAGG + Intronic
1119259565 14:73229573-73229595 TCACAGAGACAGAGCTGGAATGG - Intergenic
1119551327 14:75515969-75515991 ACAGGGGGACTGAACTGGTAAGG + Intergenic
1120958155 14:90101231-90101253 AGAGAGAGACTGAACAACAAGGG - Intronic
1121894660 14:97635677-97635699 AGAGGGACAGTGAACTGGAAAGG - Intergenic
1122149907 14:99719595-99719617 ACACAGAGACAGAAGTGGAATGG - Intronic
1122236297 14:100332411-100332433 ACAGAGAGACTGAGCTGGGTTGG + Intergenic
1123720107 15:23053013-23053035 ACACACAGACTGAAAAGGAAGGG - Intergenic
1124057122 15:26251746-26251768 ACAAATAGATTGAAATGGAAAGG - Intergenic
1125872371 15:43113802-43113824 ACACAGATACATAACTGGAAAGG - Intronic
1126208084 15:46069154-46069176 AGAGAAAGACTGACCTTGAAAGG - Intergenic
1126376278 15:48000066-48000088 ACAGAGAGACTTATCTGAAATGG - Intergenic
1126572080 15:50163554-50163576 CCACAGAGACTGAACTGGGTTGG + Intronic
1126730555 15:51677650-51677672 ATAGAGAGCCTGAGCTGGCAAGG - Intergenic
1127277688 15:57461592-57461614 ACATGGGGACTGAACTGGAGGGG + Intronic
1128499694 15:68219308-68219330 TTAGAGAGACTGAAATGGATAGG + Intronic
1128720863 15:69947422-69947444 ACAGTGAGACTGAAACAGAAGGG - Intergenic
1129377076 15:75140488-75140510 ACAGAGAGCCGGAGGTGGAAGGG + Intergenic
1129804774 15:78446653-78446675 ACAGAGAGACTGAACTGGAAAGG - Intronic
1130054268 15:80508910-80508932 ACAGAGGTGCTGAACTGGACTGG - Intronic
1131948772 15:97657222-97657244 ATAGGGAGAATAAACTGGAAGGG + Intergenic
1132314847 15:100881941-100881963 TCAGGGAGACTGGACTGGAGAGG + Intronic
1134554935 16:15156366-15156388 ACAAATAGACCCAACTGGAATGG - Intergenic
1135055380 16:19227641-19227663 TCAGGGAGAAGGAACTGGAAAGG - Intronic
1135096568 16:19569439-19569461 ACAAAGAAAGTGAACCGGAAAGG + Exonic
1135491186 16:22911190-22911212 ACCCAGGGACAGAACTGGAAAGG + Intronic
1135813212 16:25608579-25608601 ACAGAGATATTGAAAGGGAAGGG + Intergenic
1136058978 16:27711817-27711839 ACAGAGCTACTGATCTAGAAGGG - Intronic
1136513162 16:30751506-30751528 GCAGAGAGACAGAGATGGAAAGG - Intronic
1138300418 16:55922319-55922341 ACACAGAGACTGAAAGTGAAAGG + Intronic
1139596817 16:67963067-67963089 AGAGAGGGACAGAGCTGGAAGGG + Intronic
1139679391 16:68549357-68549379 TCAGAGATACTGAAATGAAAAGG + Intronic
1140540468 16:75752077-75752099 TCAGAGAGACTGAACCAGTAGGG - Intronic
1141188763 16:81808392-81808414 CCTGAGAGACTGTACTGGAGAGG + Intronic
1141398206 16:83723520-83723542 ATAGTGAGACTGAAGTGAAAAGG - Intronic
1141603804 16:85141931-85141953 ACAGAAAGGCTGACCTGGGAGGG - Intergenic
1141871467 16:86789348-86789370 ACTGAGAGAGTGAAGTGGAGTGG - Intergenic
1148320422 17:46746869-46746891 ATTGAGAGACTGATCTGGAGAGG + Intronic
1148792577 17:50181834-50181856 AGAGAGAGACTGAGCTAGAGAGG - Intergenic
1149002968 17:51775896-51775918 ACAGAGAAACAGAAGGGGAATGG + Intronic
1149035314 17:52127562-52127584 ACAGAGATGCTTAACTGGAGTGG - Intronic
1149701472 17:58658741-58658763 ACAGAAAAACTGAACTACAAGGG + Intronic
1150533904 17:66014764-66014786 ACAGAGACACTGGGCTGAAAGGG - Intronic
1151207056 17:72515544-72515566 ACAGAGCCAGTGAACTGGAAGGG + Intergenic
1151898329 17:76995447-76995469 CCAGAGAGACAGGACTGGAAAGG - Intergenic
1152246745 17:79188499-79188521 ACAGGGAGACTGAAAGCGAAGGG + Intronic
1154061699 18:11067516-11067538 ACACAGAGACTGAAGGTGAAAGG + Intronic
1155468913 18:26170123-26170145 ACGGAGAAACTGAACTGAGAAGG - Intronic
1156217176 18:35011468-35011490 ACAGACAGACAGATCAGGAAGGG + Intronic
1156220105 18:35042255-35042277 AGAAAGAGACTGGACTGCAAAGG + Intronic
1156518577 18:37701800-37701822 AGTGAGAGACTGACCTGGAAGGG + Intergenic
1156685012 18:39633816-39633838 ACAGTGAGAATGAGCTGAAAAGG - Intergenic
1156824190 18:41410566-41410588 ATGGATAGACTGAACTTGAAGGG - Intergenic
1157673447 18:49550045-49550067 ACAGACAGTGTGAACAGGAAGGG + Intergenic
1157744077 18:50119521-50119543 TCAGAGAGAGACAACTGGAAAGG + Intronic
1157749661 18:50167014-50167036 AAAGAGAGACTCCCCTGGAAAGG + Intronic
1158293604 18:55969662-55969684 ACAGAGTGACTGAACTTTAAAGG - Intergenic
1159113826 18:64090674-64090696 AAAGAGAGACTGCAGAGGAAAGG - Intergenic
1161664448 19:5566547-5566569 ACACACAGACAGAACTGGACAGG + Intergenic
1163220145 19:15913207-15913229 ACAGAGAGAACGCACTGGGAGGG + Exonic
1165128832 19:33619915-33619937 AAAGAGAGACTTAACTGCAATGG - Intergenic
1165911382 19:39230302-39230324 AGAGAGAGAGAGAGCTGGAAGGG - Intergenic
1166093766 19:40527078-40527100 CCAGAGAGAAGGAACAGGAAGGG - Intronic
1166301553 19:41914334-41914356 GGAGAGAGACAGAAATGGAAGGG - Intronic
1167110709 19:47459027-47459049 ACAGAGAGACAGAGATGGAGAGG - Intronic
1167527145 19:49991550-49991572 TCAGAGAAACAGAACTGGCAGGG - Intronic
1167575339 19:50315088-50315110 AGAGAGAGAAAGAAATGGAAGGG + Intronic
1167872324 19:52381448-52381470 ACACACAGGCTGAAATGGAAAGG - Intronic
925351034 2:3200877-3200899 ACAGAGTGACCGAACCAGAAAGG + Intronic
925576814 2:5368886-5368908 ACAGAGAAACAGAAAAGGAAAGG - Intergenic
927561626 2:24077430-24077452 AAATAAAGAGTGAACTGGAAGGG - Exonic
927714972 2:25345949-25345971 TCATAGAGACAGAAGTGGAATGG + Intergenic
927912896 2:26914297-26914319 ACAGAGAGAATCTACCGGAAGGG - Intronic
929897084 2:45970103-45970125 ACACAGAGACTGCACAGGGAAGG - Intronic
930252964 2:49056261-49056283 ACACATAGACTGAAATTGAAAGG + Intronic
930693795 2:54390893-54390915 ACAGAGAGAAGGATGTGGAAAGG + Intergenic
931048200 2:58381220-58381242 GCTAAGAGACTGAACTAGAATGG - Intergenic
931163735 2:59722706-59722728 GCAGAGATACTGTGCTGGAAGGG + Intergenic
931712065 2:64996817-64996839 TCAGAGACAGTGAGCTGGAAGGG - Intronic
931757753 2:65388999-65389021 ACAGAGATTCTGTACTGGGAGGG + Intronic
931803357 2:65779926-65779948 ACACAGAAACTGAACTCTAAGGG - Intergenic
932538301 2:72622985-72623007 TTATAGGGACTGAACTGGAAGGG + Intronic
934136191 2:88998566-88998588 ACATAGAGACAGAACTGGAATGG - Intergenic
934137869 2:89015699-89015721 TCATAGAGACAGAACTTGAATGG - Intergenic
934139756 2:89035113-89035135 ACATAAAGACAGAACTGCAATGG - Intergenic
934145790 2:89092836-89092858 ACATAGAGGCAGAACTGGAATGG - Intergenic
934223470 2:90107732-90107754 ACATAGAGGCAGAACTGGAATGG + Intergenic
934229488 2:90165438-90165460 ACATAAAGACAGAACTGCAATGG + Intergenic
934887467 2:98037632-98037654 AAAGAGAGACTGCAAAGGAAAGG - Intergenic
935370983 2:102346617-102346639 AGAGAGAGAGTGACCTGGAAAGG + Intronic
935550070 2:104443360-104443382 AAAGAGAGACCAAACTGGAGAGG + Intergenic
935554696 2:104496367-104496389 AGAGAGAGAGAGAACTGAAATGG - Intergenic
935609104 2:105002129-105002151 ACACAATGACTGAACTAGAATGG + Intergenic
935703392 2:105834516-105834538 ACACAGAGACTGGAAGGGAAAGG - Intronic
935802846 2:106715826-106715848 ACAGAGATAGTGAACTGAAAAGG + Intergenic
936690117 2:114876922-114876944 AGAGAGAGACTGCAGAGGAAAGG - Intronic
937408432 2:121651356-121651378 TCACAGAGACAGAACTAGAATGG - Intergenic
939885296 2:147674945-147674967 ACAGTGAAACTACACTGGAATGG - Intergenic
940606773 2:155934716-155934738 ACAGAGACACTTAACTGAAAAGG + Intergenic
940760646 2:157734875-157734897 ACAGAAAGACTAAAATGAAAAGG + Intergenic
941174641 2:162181467-162181489 ACAGGGAGACTGAGCTGGCCAGG - Intronic
943206119 2:184898357-184898379 AAAGAGCTATTGAACTGGAAAGG - Intronic
943640927 2:190357421-190357443 ACAGAGAGAAAGAGCTTGAAAGG - Intronic
945658227 2:212651950-212651972 ACACAGAGAATGAACTGGTTTGG + Intergenic
946103134 2:217344278-217344300 AGACAGAGACTGAAATGGGAAGG + Intronic
946200493 2:218068316-218068338 TCAGACAGACTGAATTGGGAGGG + Intronic
946676640 2:222167532-222167554 ACAAAGACACAGCACTGGAAGGG + Intergenic
946692217 2:222318792-222318814 AGAGGGAAACTGAACAGGAAGGG - Intergenic
947695501 2:232183980-232184002 AGAGAGAGATAGAGCTGGAAAGG + Intronic
947726331 2:232403081-232403103 TCATAGAGACAGAAGTGGAATGG - Intergenic
947735888 2:232455208-232455230 ACATAGAGACAGAAGTGGAATGG - Intergenic
947762890 2:232616639-232616661 TCAGAGAGACAGAAGTAGAATGG + Intronic
948370033 2:237483053-237483075 ACAGAGAGACTGAGGGGGACGGG + Intergenic
1168869668 20:1117698-1117720 AGAGAGAGACAGGAATGGAATGG + Intronic
1169091556 20:2864135-2864157 ACAGAGAGAAGGAGCTGGCATGG - Intronic
1170520224 20:17177604-17177626 ACAGAGAAACTGAGCTGGGCAGG + Intergenic
1170707205 20:18755084-18755106 AGAGAAACACAGAACTGGAAGGG - Intronic
1170760455 20:19244537-19244559 TCAGAGAGACTGAGCATGAAAGG + Intronic
1172029574 20:31972393-31972415 ACAGAGAGATTGAACTCTGAGGG + Intronic
1172381830 20:34500528-34500550 ACATACAGACTGAAAAGGAAGGG - Intronic
1172557028 20:35851304-35851326 CCCCAGAGACTGAACTGGCAGGG - Intronic
1172993962 20:39056214-39056236 ACAGGGAGTCTGAACTGGGAAGG + Intergenic
1174852104 20:54005693-54005715 CAAGAGTGACTGAACTAGAAGGG + Intronic
1174913269 20:54629757-54629779 ACAGAGAGAATGACCGGGAATGG + Intronic
1175199982 20:57270280-57270302 AAAGAGAGAGTGAAGTGGAAGGG + Intergenic
1175322485 20:58099233-58099255 CCAGAAAGCCTGAATTGGAAAGG - Intergenic
1175570650 20:60018467-60018489 ACACATAGACTGAACATGAAGGG - Intronic
1177633296 21:23753906-23753928 TCTGAGAGAGTGAACTGAAAAGG + Intergenic
1178056268 21:28802404-28802426 ACATAGAGAGGGAGCTGGAATGG + Intergenic
1183087203 22:35493730-35493752 ACAGAGTTTCTGAGCTGGAAGGG - Intergenic
1183757682 22:39785279-39785301 ACAGAGTGGCTGATGTGGAATGG - Intronic
1184094456 22:42309090-42309112 ACAGAGAGGCTGGCCTGGAAGGG + Intronic
1184837016 22:47029781-47029803 ACAGCGCGCCTGAGCTGGAAGGG - Intronic
1185209263 22:49559476-49559498 ACGGAGAGACAGAACTTTAAGGG + Intronic
949849316 3:8406535-8406557 ACAGCCAGATTGAACTGAAAGGG + Intergenic
950429386 3:12942051-12942073 ACAGAGAAACTGAACCCGAGTGG - Intronic
950578540 3:13847442-13847464 ACTGAGACCCTGAACTGGAGGGG - Intronic
950943568 3:16920485-16920507 ATTGAGAATCTGAACTGGAAAGG + Intronic
952081283 3:29760420-29760442 AGAGAGAGATTGAACAGGGAGGG + Intronic
953284884 3:41596994-41597016 ACAGAGAGACTGGGGTGGGATGG - Intronic
953572096 3:44079244-44079266 ACAGACAGGGTGAAGTGGAAAGG + Intergenic
954575540 3:51674107-51674129 ACACACAGAGTGACCTGGAAGGG - Intronic
954616290 3:51970266-51970288 ACAGAGAAACTGACCTAGGAGGG - Intronic
954832159 3:53430738-53430760 ACAGACAGACCCCACTGGAAAGG - Intergenic
955105712 3:55895854-55895876 ACAGAGAGCAAGAACTTGAAGGG - Intronic
956715222 3:72073588-72073610 ACAGTGAGGCTCAACTGGCAAGG - Intergenic
956996402 3:74831066-74831088 AGAGAGAAACAGAACAGGAAAGG - Intergenic
957961008 3:87252487-87252509 ACAGAGATACATAAATGGAATGG - Intronic
959574879 3:107924075-107924097 ACAGAAAGTTAGAACTGGAAAGG - Intergenic
960291335 3:115888982-115889004 GCAGAGAGAATGGACAGGAAGGG + Intronic
960541419 3:118866047-118866069 ACAGAGACAGTGGACTGGAGTGG - Intergenic
960621087 3:119637456-119637478 ACAGAGAGGCTTAACTTTAAAGG + Intronic
962113964 3:132482257-132482279 AAAGAGAGAGTGAAAAGGAATGG + Exonic
962809356 3:138947666-138947688 TCAGAGTGACTGGGCTGGAATGG + Intronic
963220365 3:142803301-142803323 ACAGAGAGAGAGAACGGCAAAGG + Intronic
964274038 3:154989195-154989217 ACACAGAGACTGAAAATGAAGGG + Intergenic
964384139 3:156129285-156129307 ACATAGAGACAGAACTAGAAAGG - Intronic
965200125 3:165647742-165647764 ACAGAGAGGCTGTAATGTAACGG - Intergenic
965381122 3:167989949-167989971 AGATAGAGACAGAACTGGAATGG - Intergenic
965686971 3:171314460-171314482 ACAGAGAGGCAGAAATGGGATGG - Intronic
968148059 3:196316217-196316239 ACAGAGGGCCTGAACCTGAATGG + Exonic
968250176 3:197202931-197202953 ACAGTGACAGTGAAGTGGAAGGG + Intronic
968354609 3:198094918-198094940 GCAGAGAGGAGGAACTGGAATGG + Intergenic
969140284 4:5065123-5065145 ACAGAGTGACTGAACATGCAGGG - Intronic
969498181 4:7538097-7538119 ACAGAGAGGCAGACCTGGCAAGG - Intronic
969887531 4:10228893-10228915 ACAGTGAGCCTGAAAGGGAATGG - Intergenic
972461758 4:39310592-39310614 ACAGAGAGACAGAAACTGAAGGG + Intronic
975877006 4:78852953-78852975 ACAGAGACACTGAAATAAAATGG - Intronic
975920270 4:79378994-79379016 GCAGAGAGAACGAAGTGGAATGG - Intergenic
978181989 4:105809478-105809500 ACAGATAGGCTGACCTGAAAGGG - Intronic
978763646 4:112382030-112382052 AGAAAGGGACTGAAATGGAATGG - Intronic
979293459 4:119003651-119003673 ACATAGAGACTATACTGGGAGGG - Intronic
980873315 4:138634921-138634943 ATAGACTGACAGAACTGGAAGGG - Intergenic
982053163 4:151523767-151523789 ATTAAGAGACTGGACTGGAAAGG - Intronic
982081166 4:151791723-151791745 TCAGAGATACTCATCTGGAATGG + Intergenic
982465409 4:155723992-155724014 ACTGAGAGTCTGGGCTGGAAAGG - Intronic
982832205 4:160076668-160076690 ACAGAGACACTTAAATGTAATGG + Intergenic
982906930 4:161086195-161086217 ACAGAGAAACTAAAATGGCATGG - Intergenic
986443610 5:7801972-7801994 ACAGAGAGGTTTAACTGGCAAGG + Intronic
986553750 5:8988675-8988697 ACACAGAGACTGAAAATGAAGGG - Intergenic
986677773 5:10201977-10201999 AAAAAGTGGCTGAACTGGAATGG - Intergenic
986892757 5:12329349-12329371 ACAGAGATACTGAATTTGTAGGG - Intergenic
989112750 5:37923106-37923128 ACAGTGAGAATGAAGAGGAAGGG - Intergenic
990632635 5:57687385-57687407 TCAGAGATATTGAACTGAAAAGG - Intergenic
991095904 5:62739484-62739506 ACAGTGATACTGAACTGAACAGG - Intergenic
991222557 5:64233819-64233841 ACAGAGTGTTAGAACTGGAAAGG + Intronic
991472783 5:66986532-66986554 ACAGAGAGAAAGTACTGGAAAGG - Intronic
992619094 5:78574892-78574914 ACAGAGAGACTGAGGTGGTGAGG - Intronic
992834693 5:80628487-80628509 ACGGAGAAACTGAACTGAGAAGG - Exonic
993693598 5:91033646-91033668 ACAGAGAATCAGAACTGGGAAGG - Intronic
994058642 5:95448502-95448524 ACTGAGGGATTGAACAGGAAAGG - Intronic
994662008 5:102665299-102665321 ACTGAGAGATTGTACTGGAGGGG - Intergenic
995369732 5:111405659-111405681 ACAGGGAGACTGGCCTGGAGGGG + Intronic
995652417 5:114384774-114384796 ACAGAAGGGCTGCACTGGAAGGG + Intronic
995684574 5:114758322-114758344 ACAGACACACAAAACTGGAATGG + Intergenic
995868238 5:116716130-116716152 AAAGTGACTCTGAACTGGAAGGG + Intergenic
996105768 5:119500732-119500754 AAAAAGAGACTGCACAGGAATGG + Intronic
996958499 5:129214674-129214696 ACACATAAACTGAAATGGAAGGG - Intergenic
999794570 5:154977012-154977034 ACACAGAGACAGAAGTAGAATGG - Intergenic
999942657 5:156561279-156561301 ACAGAAAGCCAGACCTGGAAGGG - Intronic
1000861528 5:166461817-166461839 ACAGAAAGACTGAAAGGTAAAGG + Intergenic
1001379625 5:171295546-171295568 ACAGAAAGACTGAAATGGGAGGG - Intronic
1001439184 5:171725724-171725746 ACAAAGAAACTGAACTAGGATGG - Intergenic
1001701376 5:173708962-173708984 AAACAGAGACTGAAATGGAGTGG - Intergenic
1002078473 5:176723685-176723707 AGAGAGAGACAGAACTGGTCTGG - Intergenic
1003824314 6:9935726-9935748 AAAGAGAGACTGAATTGAGAAGG - Intronic
1004171970 6:13302326-13302348 ACAGAGGGACCAAAGTGGAAAGG + Intronic
1005254332 6:23983923-23983945 ACAGAGAGAGAGAATGGGAAGGG + Intergenic
1005591914 6:27337474-27337496 ACAGAGAAGTTGAAGTGGAAGGG + Intergenic
1006709130 6:36050231-36050253 ACAGAGAGAGAGAAGTGCAAGGG + Intronic
1007545236 6:42688299-42688321 GCTGCCAGACTGAACTGGAAGGG + Exonic
1008794279 6:55282195-55282217 ACAGAGAGAATGAAAGGAAAAGG - Intronic
1009663243 6:66642332-66642354 AGAGAGAGAGTGAACAAGAATGG - Intergenic
1010528814 6:76941642-76941664 ACAGAGACAGTGAACTTGGATGG + Intergenic
1010701404 6:79052576-79052598 ACAATGAGAATGAATTGGAAAGG + Intronic
1010772729 6:79850273-79850295 ACACAGAGACTGAAAATGAAGGG + Intergenic
1011237729 6:85236298-85236320 ACAGAGAGTCTCACATGGAAAGG + Intergenic
1011290655 6:85773159-85773181 ACATAGAAGCTGAAATGGAAGGG - Intergenic
1011917703 6:92528809-92528831 ACAGATAGACTGAAAGTGAAGGG + Intergenic
1011985930 6:93445961-93445983 ACACAGTCACTGAGCTGGAAAGG - Intergenic
1012833929 6:104241422-104241444 AAAAAGAGACAGAACTGCAAAGG - Intergenic
1013937406 6:115615018-115615040 TTAGAGAGAAGGAACTGGAATGG - Intergenic
1013990727 6:116251835-116251857 TCAGAAAGACTAAGCTGGAAGGG + Exonic
1015875346 6:137816982-137817004 CCAGTGTGACTGAAATGGAAAGG + Intergenic
1016251484 6:142048672-142048694 CCAGAGACAGTGAACTGGGAAGG + Intergenic
1016488880 6:144573966-144573988 ACAAGGATACTGAACTGGGATGG + Intronic
1017305668 6:152915473-152915495 ACAGAGAGCAGGCACTGGAATGG + Intergenic
1017594877 6:156017614-156017636 ACAGAAGTACAGAACTGGAAAGG + Intergenic
1017604036 6:156113956-156113978 ACAGAGAGACTCAGTTGAAAAGG - Intergenic
1018411631 6:163554803-163554825 ACAGAGAGGATGAACTGGACTGG - Intronic
1019413817 7:918517-918539 AGAGAGAGGCTGCCCTGGAATGG - Intronic
1019601446 7:1885787-1885809 GGAGAGAGACAGGACTGGAAGGG - Intronic
1022483938 7:30763344-30763366 GCATAGAGACTGAAGTAGAAGGG + Intronic
1023171461 7:37393829-37393851 AAGGAGAGGCTGAACTAGAAGGG + Intronic
1023233631 7:38060662-38060684 ACAAAGACACTGAAATGTAATGG + Intergenic
1023494892 7:40784578-40784600 ACAGAAAAGATGAACTGGAAAGG - Intronic
1023826518 7:44013703-44013725 ACAGAGAGAGTGAAGTGGGAGGG + Intergenic
1023927473 7:44680276-44680298 CCAGAGAGACAGAACTGAGAGGG - Intronic
1024962969 7:54996815-54996837 ACATAGAGAATGAACTGGGGGGG - Intergenic
1025118805 7:56281677-56281699 ACAGAGAGGTGGCACTGGAAGGG + Intergenic
1026090096 7:67292573-67292595 ACAGAGAGAGTGAAGTGGGAGGG + Intergenic
1026498549 7:70923678-70923700 ACAGAGAGGCTAAGCTTGAACGG + Intergenic
1026868629 7:73837515-73837537 ACAGAAAGACTGCCCTGGGAAGG - Intronic
1027119687 7:75507891-75507913 ACAGAGAGAGTGAAGTGGGAGGG + Intergenic
1027272138 7:76527720-76527742 ACAGAGAGAGTGAAGTGGGAGGG - Intergenic
1027379927 7:77596826-77596848 ACAAAGAGACTGCTCTGGTAGGG - Intronic
1027411087 7:77918495-77918517 GAAGAGAGAATGTACTGGAAAGG - Intronic
1028717670 7:93991652-93991674 ACAGAGAAACTGAGATGGAGAGG + Intronic
1029717810 7:102342136-102342158 ACAGAGAGAGTGAAGTGGGAGGG - Intergenic
1029754805 7:102567107-102567129 ACAGAGAGAGTGAAGTGGGAGGG + Intronic
1029772755 7:102666187-102666209 ACAGAGAGAGTGAAGTGGGAGGG + Intronic
1029892144 7:103941862-103941884 ACAGAGAGAGAGAACTTGCAAGG + Intronic
1030396013 7:108987957-108987979 ACAGAGAAACTGAAGAAGAATGG + Intergenic
1030889365 7:114980332-114980354 ACAGTGAGGCTGAAATGGGATGG - Intronic
1032382194 7:131496995-131497017 AAGGAAAGACTGAACTGAAATGG + Intergenic
1032951467 7:136919593-136919615 AGAGAGAGAATAAACTGGAGTGG - Intronic
1032961354 7:137038490-137038512 AAAGAGAGACAGAAATGCAATGG - Intergenic
1033291721 7:140090848-140090870 AAAGAGACCTTGAACTGGAAAGG - Exonic
1033468403 7:141620062-141620084 AGAAAAAAACTGAACTGGAAAGG + Intronic
1034244690 7:149635581-149635603 TCAGAGAGACAGAACTGGCCTGG + Intergenic
1034746720 7:153529626-153529648 ACAGAGAGACTGTCAGGGAAGGG - Intergenic
1034939957 7:155224196-155224218 ACAGAGAGACAGAACCAGAGAGG + Intergenic
1035861201 8:3029740-3029762 GCAGTCAGACTGAACTGTAAAGG + Intronic
1036424138 8:8627901-8627923 ACAGAGATACTGAGTTGAAATGG - Intergenic
1036974206 8:13392078-13392100 ACAGGTACACTGAAATGGAATGG - Intronic
1037989237 8:23308784-23308806 ACAGACTGACAGAGCTGGAAGGG + Intronic
1039121763 8:34156047-34156069 ACACAGAGACTAAAAAGGAAAGG - Intergenic
1042043486 8:64621598-64621620 AGCAAGAGACTGAGCTGGAAAGG + Intronic
1042526962 8:69773571-69773593 ACAGAGAGAATGAATGAGAAGGG - Intronic
1042757126 8:72227419-72227441 ACAGAGAGAATGAATTCCAAGGG + Intergenic
1042956848 8:74260208-74260230 ACAGCGAGGCAGAACTGGCAAGG + Intronic
1043359625 8:79457268-79457290 TCAGAGTCACTGAACTGCAATGG + Intergenic
1043495557 8:80796873-80796895 AAAGAGAGAGGGAAATGGAAAGG + Intronic
1043936580 8:86149249-86149271 AAGGAGAGACTGAGATGGAATGG + Intronic
1044801900 8:95965660-95965682 ACAGAGAGACAGGGGTGGAAGGG + Intergenic
1045699907 8:104853665-104853687 AGAGAGAGACTGAAATAGGAAGG + Intronic
1046788172 8:118290801-118290823 ATAGAAATCCTGAACTGGAAGGG - Intronic
1047456239 8:125015259-125015281 ACAAAGAGACTGAAAATGAAGGG - Intronic
1047500167 8:125434076-125434098 ACAGAGAACCTGGACTGGGATGG - Intronic
1048980334 8:139700093-139700115 ACAAACAGAATTAACTGGAAAGG + Intronic
1049398129 8:142411445-142411467 TTAGAGTGACTGACCTGGAAGGG + Intergenic
1049921672 9:370426-370448 ACAGAGTCACGGAACTGGCATGG - Intronic
1050530727 9:6586743-6586765 ATAGATAGACTAATCTGGAAGGG + Intronic
1050625918 9:7503516-7503538 AGAGAGAGAAAGCACTGGAAGGG + Intergenic
1050789508 9:9448437-9448459 AGAGAGAGAATGAACTGCAAAGG - Intronic
1050877205 9:10653567-10653589 ACACAGAGACTGAAAGTGAAGGG + Intergenic
1053166778 9:35850030-35850052 ACAGTGAGAATGACCTGGGATGG - Intronic
1053488085 9:38476856-38476878 ACACACAGACTGAAAGGGAAGGG + Intergenic
1054752361 9:68920752-68920774 ACAGAGAGACAGAGACGGAATGG - Intronic
1054820327 9:69515587-69515609 AAGGAGAGACTTCACTGGAAAGG - Intronic
1056017452 9:82405344-82405366 ACAGAGAGAATGGACTAGACTGG - Intergenic
1058584137 9:106488406-106488428 ACAGAGAAACTCAGCTGCAAAGG + Intergenic
1058605572 9:106719131-106719153 AAAGAGGGACTGGACTGAAATGG - Intergenic
1059772648 9:117442284-117442306 TCAGAGACACTTAACAGGAATGG + Intergenic
1059899110 9:118902685-118902707 ACAGACAGAATGGATTGGAAAGG - Intergenic
1061449066 9:130659069-130659091 ACAGAGAGACTGGAGTGTGAGGG - Intergenic
1061618704 9:131796770-131796792 ACCGACAGCCAGAACTGGAAGGG + Intergenic
1062007796 9:134250104-134250126 ACAGAGAGGCTGGAGTGCAATGG - Intergenic
1062138971 9:134945033-134945055 AGATTGAGACTGAACTGGACCGG + Intergenic
1062146955 9:134994836-134994858 ACAGAGAGATGGAAGAGGAAAGG - Intergenic
1203343644 Un_KI270442v1:16035-16057 ACGAAGGGACTGGACTGGAATGG + Intergenic
1203345315 Un_KI270442v1:30011-30033 TCAAACAGAATGAACTGGAATGG + Intergenic
1203674972 Un_KI270756v1:14252-14274 AAAGAGAGAATGGAATGGAATGG - Intergenic
1203676362 Un_KI270756v1:25983-26005 ACGAATAGAATGAACTGGAATGG - Intergenic
1187201490 X:17137948-17137970 AAAGAGCAACTGAACTAGAATGG - Intronic
1187549262 X:20284856-20284878 ACAGAGAGAGTGAATTTGAGGGG - Intergenic
1187945820 X:24425552-24425574 AGAGAGAGAGTGAAGTGGAGAGG + Intergenic
1188903418 X:35762478-35762500 ACTGAGAGTCTGAGCTGGCAAGG + Intergenic
1190458523 X:50647642-50647664 ACAGTGAGTTTGAACTGAAAGGG - Intronic
1190569581 X:51768058-51768080 AAAGAGAGACTGAATAAGAAAGG - Intergenic
1190823225 X:53993789-53993811 ACATGGACACTGAAGTGGAATGG + Exonic
1191628938 X:63300077-63300099 AAAGAGAAACTGAACTGACATGG - Intergenic
1192326859 X:70140056-70140078 TTAAAGAGACTGATCTGGAAAGG - Intronic
1193468707 X:81875191-81875213 ACAGAGAGGATGACCTAGAATGG + Intergenic
1193524568 X:82573277-82573299 CCAGAGACAGTGAAATGGAAGGG - Intergenic
1193584613 X:83305743-83305765 AAAGTAAGTCTGAACTGGAAGGG - Intergenic
1193831641 X:86295444-86295466 CCAGAGAGAGTGAACTGGTTGGG - Intronic
1194831748 X:98631812-98631834 CCAGAGAGAGTGAACTGGGTTGG + Intergenic
1195976389 X:110532232-110532254 AACCATAGACTGAACTGGAAGGG - Intergenic
1196588676 X:117460325-117460347 CCAGAGACAGTGAACTGGAGGGG + Intergenic
1197527398 X:127579115-127579137 ACACACAGACTGAAATGAAAAGG - Intergenic
1198115996 X:133545145-133545167 ACAGAGACACTGTACAGCAAGGG + Intronic
1198241291 X:134789222-134789244 ACAGAGAAACTGCACATGAAAGG - Exonic
1199236756 X:145502098-145502120 AAAGAGAGAATGTATTGGAAGGG - Intergenic
1199364000 X:146957050-146957072 CCAGAGAGAGTGAACTGGGAGGG + Intergenic
1199372719 X:147070045-147070067 TCAGAGAGACTGGAGAGGAAGGG + Intergenic
1199654146 X:149978079-149978101 AAAGAGAGACTTATCTGAAAAGG - Intergenic
1199753404 X:150842622-150842644 ACAAAAACACTTAACTGGAATGG - Intronic
1200724827 Y:6656663-6656685 ACAGAAATACTGAACTTAAATGG - Intergenic
1200762591 Y:7053831-7053853 ACTGAAAGACTGAAAAGGAAAGG + Intronic
1201719544 Y:17081543-17081565 ACAGAAAGAGTGAACTGCACAGG - Intergenic