ID: 1129805293

View in Genome Browser
Species Human (GRCh38)
Location 15:78451577-78451599
Sequence GTAAACAATACGAGTACTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 33
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 31}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129805293 Original CRISPR GTAAACAATACGAGTACTAC AGG Intronic
910206037 1:84749628-84749650 GTGAACAACATGAGAACTACAGG + Intergenic
910371628 1:86523080-86523102 GTAAATAGTACCAGTAGTACTGG + Intergenic
921671762 1:217933091-217933113 GTAAAAAAAAAGAGTAATACAGG - Intergenic
1068901324 10:62272603-62272625 GTAAACATTACAATTAATACTGG - Intergenic
1072552114 10:96487008-96487030 GTGAACAATACGAAGACTGCAGG - Intronic
1079520574 11:21321493-21321515 TTAAAAAATAAGAGTTCTACTGG + Intronic
1109857390 13:68149458-68149480 GTGAGCAATATGAGTACTGCTGG + Intergenic
1119314135 14:73677268-73677290 GTTAAAAATATGAATACTACTGG - Intronic
1129805293 15:78451577-78451599 GTAAACAATACGAGTACTACAGG + Intronic
1158558935 18:58497779-58497801 ATAACCAATAGGAGTACCACGGG - Intronic
1168594934 19:57667843-57667865 GTAGACAATGTGAGTACCACTGG - Intergenic
925549331 2:5053472-5053494 GTAAAAAATAAGTGTATTACAGG - Intergenic
937801752 2:126088830-126088852 GTAACCAATACGCATAGTACTGG + Intergenic
937951478 2:127391155-127391177 GAAAATGATACGAGTACTATTGG + Intergenic
948659500 2:239498402-239498424 GTAAACAATTGGAGGACTTCGGG + Intergenic
1170318714 20:15070204-15070226 GTAAACAATCCCATTACTACAGG - Intronic
1172459087 20:35101876-35101898 GTAAACAATCCAAGAACCACTGG - Intergenic
957527990 3:81402237-81402259 GTATATAAAATGAGTACTACAGG + Intergenic
960709458 3:120512918-120512940 GTAAACAATTCTATTACTAGGGG - Intergenic
971901600 4:32666481-32666503 GAAAAGAATTCCAGTACTACAGG - Intergenic
972019964 4:34300093-34300115 GTCAACAACAGGAATACTACTGG - Intergenic
976499422 4:85770389-85770411 GTGAACAATAGGAGGACTATTGG - Intronic
979550358 4:121984196-121984218 GTAAACAATTTGAGTCCCACAGG + Intergenic
986473583 5:8100391-8100413 ATGAAAAATATGAGTACTACTGG + Intergenic
989206543 5:38814929-38814951 TTAAATAATAAGAGTACGACAGG - Intergenic
996785365 5:127231173-127231195 GTAAACATCACGATGACTACAGG - Intergenic
999861224 5:155648662-155648684 TTAAAGAATACCAGTTCTACGGG - Intergenic
1012342683 6:98147275-98147297 TTATACAATATGAGAACTACAGG + Intergenic
1043354691 8:79399038-79399060 GTTAACAATACAATTACTAAGGG + Intergenic
1044262322 8:90140284-90140306 GTAAACAATAAGTTTACTAGTGG + Intergenic
1050338670 9:4614240-4614262 GTGAACAATGGGAGTACTAAAGG - Intronic
1051137744 9:13942059-13942081 GTAAACACTGCAAGTGCTACTGG + Intergenic
1189591948 X:42522804-42522826 GTAAATAATATGAGTACAATGGG - Intergenic