ID: 1129810822

View in Genome Browser
Species Human (GRCh38)
Location 15:78508209-78508231
Sequence CACGGGGCAGTTCAACCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 92}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129810822_1129810828 4 Left 1129810822 15:78508209-78508231 CCTTGGGGTTGAACTGCCCCGTG 0: 1
1: 0
2: 0
3: 5
4: 92
Right 1129810828 15:78508236-78508258 TGTGGAATGAAGGTCACCCTTGG 0: 1
1: 0
2: 0
3: 11
4: 158
1129810822_1129810826 -6 Left 1129810822 15:78508209-78508231 CCTTGGGGTTGAACTGCCCCGTG 0: 1
1: 0
2: 0
3: 5
4: 92
Right 1129810826 15:78508226-78508248 CCCGTGAGTCTGTGGAATGAAGG 0: 1
1: 0
2: 0
3: 6
4: 128
1129810822_1129810832 29 Left 1129810822 15:78508209-78508231 CCTTGGGGTTGAACTGCCCCGTG 0: 1
1: 0
2: 0
3: 5
4: 92
Right 1129810832 15:78508261-78508283 CACCATTTAATATTAAATAAGGG 0: 1
1: 0
2: 1
3: 32
4: 362
1129810822_1129810831 28 Left 1129810822 15:78508209-78508231 CCTTGGGGTTGAACTGCCCCGTG 0: 1
1: 0
2: 0
3: 5
4: 92
Right 1129810831 15:78508260-78508282 TCACCATTTAATATTAAATAAGG 0: 1
1: 0
2: 9
3: 39
4: 486

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129810822 Original CRISPR CACGGGGCAGTTCAACCCCA AGG (reversed) Intronic