ID: 1129810828

View in Genome Browser
Species Human (GRCh38)
Location 15:78508236-78508258
Sequence TGTGGAATGAAGGTCACCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 158}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129810815_1129810828 26 Left 1129810815 15:78508187-78508209 CCACCTTTCTGTTTCATGATCCC 0: 1
1: 0
2: 4
3: 29
4: 361
Right 1129810828 15:78508236-78508258 TGTGGAATGAAGGTCACCCTTGG 0: 1
1: 0
2: 0
3: 11
4: 158
1129810813_1129810828 28 Left 1129810813 15:78508185-78508207 CCCCACCTTTCTGTTTCATGATC 0: 1
1: 0
2: 1
3: 30
4: 303
Right 1129810828 15:78508236-78508258 TGTGGAATGAAGGTCACCCTTGG 0: 1
1: 0
2: 0
3: 11
4: 158
1129810816_1129810828 23 Left 1129810816 15:78508190-78508212 CCTTTCTGTTTCATGATCCCCTT 0: 1
1: 0
2: 2
3: 33
4: 422
Right 1129810828 15:78508236-78508258 TGTGGAATGAAGGTCACCCTTGG 0: 1
1: 0
2: 0
3: 11
4: 158
1129810822_1129810828 4 Left 1129810822 15:78508209-78508231 CCTTGGGGTTGAACTGCCCCGTG 0: 1
1: 0
2: 0
3: 5
4: 92
Right 1129810828 15:78508236-78508258 TGTGGAATGAAGGTCACCCTTGG 0: 1
1: 0
2: 0
3: 11
4: 158
1129810821_1129810828 5 Left 1129810821 15:78508208-78508230 CCCTTGGGGTTGAACTGCCCCGT 0: 1
1: 0
2: 1
3: 4
4: 50
Right 1129810828 15:78508236-78508258 TGTGGAATGAAGGTCACCCTTGG 0: 1
1: 0
2: 0
3: 11
4: 158
1129810814_1129810828 27 Left 1129810814 15:78508186-78508208 CCCACCTTTCTGTTTCATGATCC 0: 1
1: 0
2: 0
3: 15
4: 230
Right 1129810828 15:78508236-78508258 TGTGGAATGAAGGTCACCCTTGG 0: 1
1: 0
2: 0
3: 11
4: 158
1129810820_1129810828 6 Left 1129810820 15:78508207-78508229 CCCCTTGGGGTTGAACTGCCCCG 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1129810828 15:78508236-78508258 TGTGGAATGAAGGTCACCCTTGG 0: 1
1: 0
2: 0
3: 11
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129810828 Original CRISPR TGTGGAATGAAGGTCACCCT TGG Intronic