ID: 1129810831

View in Genome Browser
Species Human (GRCh38)
Location 15:78508260-78508282
Sequence TCACCATTTAATATTAAATA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 535
Summary {0: 1, 1: 0, 2: 9, 3: 39, 4: 486}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129810821_1129810831 29 Left 1129810821 15:78508208-78508230 CCCTTGGGGTTGAACTGCCCCGT 0: 1
1: 0
2: 1
3: 4
4: 50
Right 1129810831 15:78508260-78508282 TCACCATTTAATATTAAATAAGG 0: 1
1: 0
2: 9
3: 39
4: 486
1129810825_1129810831 11 Left 1129810825 15:78508226-78508248 CCCGTGAGTCTGTGGAATGAAGG 0: 1
1: 0
2: 2
3: 28
4: 200
Right 1129810831 15:78508260-78508282 TCACCATTTAATATTAAATAAGG 0: 1
1: 0
2: 9
3: 39
4: 486
1129810822_1129810831 28 Left 1129810822 15:78508209-78508231 CCTTGGGGTTGAACTGCCCCGTG 0: 1
1: 0
2: 0
3: 5
4: 92
Right 1129810831 15:78508260-78508282 TCACCATTTAATATTAAATAAGG 0: 1
1: 0
2: 9
3: 39
4: 486
1129810820_1129810831 30 Left 1129810820 15:78508207-78508229 CCCCTTGGGGTTGAACTGCCCCG 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1129810831 15:78508260-78508282 TCACCATTTAATATTAAATAAGG 0: 1
1: 0
2: 9
3: 39
4: 486
1129810827_1129810831 10 Left 1129810827 15:78508227-78508249 CCGTGAGTCTGTGGAATGAAGGT 0: 1
1: 0
2: 0
3: 14
4: 217
Right 1129810831 15:78508260-78508282 TCACCATTTAATATTAAATAAGG 0: 1
1: 0
2: 9
3: 39
4: 486
1129810824_1129810831 12 Left 1129810824 15:78508225-78508247 CCCCGTGAGTCTGTGGAATGAAG 0: 1
1: 0
2: 1
3: 9
4: 97
Right 1129810831 15:78508260-78508282 TCACCATTTAATATTAAATAAGG 0: 1
1: 0
2: 9
3: 39
4: 486

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129810831 Original CRISPR TCACCATTTAATATTAAATA AGG Intronic