ID: 1129810832

View in Genome Browser
Species Human (GRCh38)
Location 15:78508261-78508283
Sequence CACCATTTAATATTAAATAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 396
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 362}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129810821_1129810832 30 Left 1129810821 15:78508208-78508230 CCCTTGGGGTTGAACTGCCCCGT 0: 1
1: 0
2: 1
3: 4
4: 50
Right 1129810832 15:78508261-78508283 CACCATTTAATATTAAATAAGGG 0: 1
1: 0
2: 1
3: 32
4: 362
1129810824_1129810832 13 Left 1129810824 15:78508225-78508247 CCCCGTGAGTCTGTGGAATGAAG 0: 1
1: 0
2: 1
3: 9
4: 97
Right 1129810832 15:78508261-78508283 CACCATTTAATATTAAATAAGGG 0: 1
1: 0
2: 1
3: 32
4: 362
1129810825_1129810832 12 Left 1129810825 15:78508226-78508248 CCCGTGAGTCTGTGGAATGAAGG 0: 1
1: 0
2: 2
3: 28
4: 200
Right 1129810832 15:78508261-78508283 CACCATTTAATATTAAATAAGGG 0: 1
1: 0
2: 1
3: 32
4: 362
1129810822_1129810832 29 Left 1129810822 15:78508209-78508231 CCTTGGGGTTGAACTGCCCCGTG 0: 1
1: 0
2: 0
3: 5
4: 92
Right 1129810832 15:78508261-78508283 CACCATTTAATATTAAATAAGGG 0: 1
1: 0
2: 1
3: 32
4: 362
1129810827_1129810832 11 Left 1129810827 15:78508227-78508249 CCGTGAGTCTGTGGAATGAAGGT 0: 1
1: 0
2: 0
3: 14
4: 217
Right 1129810832 15:78508261-78508283 CACCATTTAATATTAAATAAGGG 0: 1
1: 0
2: 1
3: 32
4: 362

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129810832 Original CRISPR CACCATTTAATATTAAATAA GGG Intronic