ID: 1129814267

View in Genome Browser
Species Human (GRCh38)
Location 15:78538343-78538365
Sequence CTAAGCTGCCTGGTTACAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129814264_1129814267 17 Left 1129814264 15:78538303-78538325 CCCAAGGAAAAGGGGAAAAAATT No data
Right 1129814267 15:78538343-78538365 CTAAGCTGCCTGGTTACAACTGG No data
1129814265_1129814267 16 Left 1129814265 15:78538304-78538326 CCAAGGAAAAGGGGAAAAAATTT No data
Right 1129814267 15:78538343-78538365 CTAAGCTGCCTGGTTACAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129814267 Original CRISPR CTAAGCTGCCTGGTTACAAC TGG Intergenic
No off target data available for this crispr