ID: 1129814402

View in Genome Browser
Species Human (GRCh38)
Location 15:78539495-78539517
Sequence ATGATCAGGTTCACACTTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129814402_1129814406 28 Left 1129814402 15:78539495-78539517 CCCAAAAGTGTGAACCTGATCAT No data
Right 1129814406 15:78539546-78539568 AGTGTCTTTCTCTGTCACCCAGG 0: 11
1: 786
2: 19296
3: 76592
4: 147905

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129814402 Original CRISPR ATGATCAGGTTCACACTTTT GGG (reversed) Intergenic
No off target data available for this crispr