ID: 1129814406

View in Genome Browser
Species Human (GRCh38)
Location 15:78539546-78539568
Sequence AGTGTCTTTCTCTGTCACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 244590
Summary {0: 11, 1: 786, 2: 19296, 3: 76592, 4: 147905}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129814404_1129814406 14 Left 1129814404 15:78539509-78539531 CCTGATCATAATTTTTTTTAATT No data
Right 1129814406 15:78539546-78539568 AGTGTCTTTCTCTGTCACCCAGG 0: 11
1: 786
2: 19296
3: 76592
4: 147905
1129814400_1129814406 30 Left 1129814400 15:78539493-78539515 CCCCCAAAAGTGTGAACCTGATC No data
Right 1129814406 15:78539546-78539568 AGTGTCTTTCTCTGTCACCCAGG 0: 11
1: 786
2: 19296
3: 76592
4: 147905
1129814403_1129814406 27 Left 1129814403 15:78539496-78539518 CCAAAAGTGTGAACCTGATCATA No data
Right 1129814406 15:78539546-78539568 AGTGTCTTTCTCTGTCACCCAGG 0: 11
1: 786
2: 19296
3: 76592
4: 147905
1129814401_1129814406 29 Left 1129814401 15:78539494-78539516 CCCCAAAAGTGTGAACCTGATCA No data
Right 1129814406 15:78539546-78539568 AGTGTCTTTCTCTGTCACCCAGG 0: 11
1: 786
2: 19296
3: 76592
4: 147905
1129814402_1129814406 28 Left 1129814402 15:78539495-78539517 CCCAAAAGTGTGAACCTGATCAT No data
Right 1129814406 15:78539546-78539568 AGTGTCTTTCTCTGTCACCCAGG 0: 11
1: 786
2: 19296
3: 76592
4: 147905

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129814406 Original CRISPR AGTGTCTTTCTCTGTCACCC AGG Intergenic
Too many off-targets to display for this crispr