ID: 1129814939

View in Genome Browser
Species Human (GRCh38)
Location 15:78543497-78543519
Sequence CTGGCTTGACAGAGGTGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 211}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129814939 Original CRISPR CTGGCTTGACAGAGGTGACA GGG (reversed) Intronic
900774008 1:4568061-4568083 CCACCTTGACAGAGGTCACAGGG - Intergenic
901199451 1:7458307-7458329 CTTCCTTGGCAGAGGTCACAGGG - Intronic
901219825 1:7577207-7577229 CTAGCCAAACAGAGGTGACAGGG - Intronic
901363226 1:8721863-8721885 CTGTCTTGACAGCAGTAACACGG + Intronic
901665576 1:10824390-10824412 CTAGCTTGATGGAGGAGACATGG + Intergenic
901839459 1:11944823-11944845 CTGGCTTGCCAGAGCTGGCGGGG - Intronic
904584372 1:31571691-31571713 CTGGCTTGTCCAAGGTCACACGG - Intergenic
905147835 1:35902009-35902031 ATGACATGACGGAGGTGACAGGG + Exonic
906040992 1:42787641-42787663 CTTGCCTGACAGAGCTCACAGGG + Intronic
911296911 1:96128846-96128868 CTGGAGTGACAGTGGTGACTGGG + Intergenic
912867358 1:113269741-113269763 GAGGCATGACAGAGGTGAGATGG - Intergenic
913512199 1:119572130-119572152 CTGGCTTCATACAGGTGACAAGG + Intergenic
915570091 1:156740669-156740691 CTGGATTGACTGAGGTGAAGGGG - Intronic
920183144 1:204144843-204144865 TTGTCTTGGCAGAGGTGGCATGG - Intronic
920989230 1:210920789-210920811 CTGGCCTGACAGAAGTGATATGG - Intronic
922876688 1:228945218-228945240 CTGGCTTCAAAGGGGTGACTAGG - Intergenic
924039465 1:239970346-239970368 CTGCCTTGAGAGAGTGGACAGGG - Intergenic
924451299 1:244181486-244181508 CTGGCTTCAGAGAGGTGACAGGG - Intergenic
1063939620 10:11113774-11113796 CTGGCTGCACAGAGGAGACTAGG - Intronic
1067360595 10:45574586-45574608 CTGGCTTGACTGAGGTGATGGGG - Intronic
1067451623 10:46385265-46385287 CTGGCCTGGCAGAGTGGACAGGG + Intronic
1067585616 10:47474491-47474513 CTGGCCTGGCAGAGTGGACAGGG - Intronic
1067817542 10:49493747-49493769 CTGGCATGGCCCAGGTGACATGG + Intronic
1070315154 10:75303234-75303256 CTGCCTTGAAAGAGGTGGGAAGG + Intergenic
1070534335 10:77363961-77363983 CTGGCTTCATAGAGTTTACATGG - Intronic
1070589550 10:77792031-77792053 GGGGGTTGACAGAGGGGACAGGG + Exonic
1070793885 10:79205759-79205781 CTTGGTTGAAATAGGTGACAAGG + Intronic
1071368107 10:84922133-84922155 ATGGCTTGCCAGAGGAGCCAAGG + Intergenic
1073476475 10:103756983-103757005 CAGGGTTGATAGAGGTGAGAGGG - Intronic
1074208255 10:111303132-111303154 CTGGCTTGAGAGCAGAGACATGG + Intergenic
1074698494 10:116072440-116072462 CTGGCTTGACTGATATGCCACGG + Intronic
1074989560 10:118691187-118691209 CTGGCTTGACATGGGAGAAATGG - Intronic
1075409254 10:122215257-122215279 CTGGAGTGACAGAGGTGGGAGGG + Intronic
1075966332 10:126614997-126615019 CTGGCTTGACTGAGGCTAGATGG + Intronic
1076043124 10:127268610-127268632 CTGGTTTGGCTGAGGTCACATGG - Intronic
1077264230 11:1641184-1641206 CTGGCTGGACAGAGACGCCAGGG - Intergenic
1080978081 11:37365759-37365781 CAGCCTTGACAGAGGTGGCTGGG - Intergenic
1083765994 11:64841957-64841979 CTGGCTTGCCCAAGGTGAGAGGG - Intronic
1085816465 11:79742393-79742415 CTGGCTTCACAGAGGGGAAGGGG - Intergenic
1086197429 11:84157621-84157643 CTGGCTTATGAGAGGTGAGAGGG - Intronic
1087729236 11:101759794-101759816 CAGACTTGACAGATATGACAAGG - Intronic
1090006201 11:123004589-123004611 ATGACTTGCCAGAGGTTACATGG - Intergenic
1090071236 11:123546288-123546310 TTGGCTTGACAGAGCTCCCAAGG - Intronic
1091041722 11:132287133-132287155 CTGGTTAGACAGATCTGACAAGG - Intronic
1091600279 12:1913805-1913827 CTGGCTTGCCTGTGGTCACACGG - Intronic
1097145083 12:56934499-56934521 CAGGGCTGTCAGAGGTGACAAGG - Intergenic
1097919101 12:65052579-65052601 TTGACTAGACGGAGGTGACAAGG - Intronic
1101991297 12:109487495-109487517 CTGGCTTGTCAGGTGAGACATGG + Intronic
1103921775 12:124403029-124403051 CTGGGTTGAGAGAGGTGCCCTGG + Intronic
1105631987 13:22178587-22178609 CTGTCTTGACAGAGGGGAGCTGG + Intergenic
1106186545 13:27414828-27414850 CTGTCTTGAAAGAGGGGAGAAGG + Intergenic
1106309038 13:28536861-28536883 CTGGGTTGACAGAGGTCAGAAGG + Intergenic
1106488277 13:30191843-30191865 CTGGCATGACACAGTTGTCATGG + Intergenic
1106901283 13:34357119-34357141 CTGGCTTGGGAGAGGTGCCCAGG + Intergenic
1107720432 13:43242727-43242749 TTAGCTTTATAGAGGTGACATGG + Intronic
1111024032 13:82494826-82494848 CTGGCTTGGCTGAAGTGACCTGG - Intergenic
1111431241 13:88150687-88150709 CAGGTTTGACAGAGCTGATATGG + Intergenic
1112374077 13:98822502-98822524 CTGACTCGGCAGAGGTGCCAGGG + Intronic
1113032098 13:106005160-106005182 TTGGCTTGAGAGATGTGAAAGGG + Intergenic
1114483728 14:23050757-23050779 CTGGCCTAAGAGAGGTGACAGGG - Intronic
1114737237 14:25054605-25054627 CTTTTTTGACTGAGGTGACATGG + Intergenic
1114775148 14:25473352-25473374 CTGGCATGCCAGAGGGGAGAGGG + Intergenic
1120284887 14:82487144-82487166 CTGATTTCACAGTGGTGACAAGG + Intergenic
1120630132 14:86880539-86880561 ATGGTTAGACAGAAGTGACATGG - Intergenic
1120998684 14:90435981-90436003 GTGACTCGACAGAGGTCACACGG + Intergenic
1121418728 14:93797532-93797554 ATGGCAAGACAGAGGAGACACGG - Intergenic
1121952262 14:98181878-98181900 CTGGATTGACAGAGGGGGCCTGG - Intergenic
1123721974 15:23068207-23068229 CAGGCTGGACAGCGGTGGCAAGG + Intergenic
1124205978 15:27720847-27720869 GTTGCTTGTCAGAGGTGATATGG - Intergenic
1124959693 15:34385158-34385180 CTGTAATGACAGAGTTGACATGG + Intronic
1124976319 15:34531379-34531401 CTGTAATGACAGAGTTGACATGG + Intronic
1125031076 15:35076843-35076865 GTGGCTTGACAGAGGGAACTTGG + Intergenic
1125906817 15:43400626-43400648 CTGGCTTCAGCGAGGTGTCATGG + Intronic
1126681554 15:51207057-51207079 ATGGCGTGAGAGAGGGGACAAGG + Intergenic
1128341369 15:66824726-66824748 CTGGGATGACAGAGGGGACTTGG - Intergenic
1129814939 15:78543497-78543519 CTGGCTTGACAGAGGTGACAGGG - Intronic
1129886317 15:79040309-79040331 CAGTCTAGGCAGAGGTGACAGGG - Intronic
1130057668 15:80542225-80542247 CTGGCTTTACAGAAGTGAAGTGG - Intronic
1130115069 15:80999703-80999725 CTGGCTGGAGAAAGGTGACTTGG + Intergenic
1130605058 15:85308126-85308148 CTGCCTTGACAGAGATGGCTGGG - Intergenic
1130726230 15:86442357-86442379 CGAGCTTGACACAGGTAACAGGG - Intronic
1131081864 15:89543358-89543380 CAGGCTTGACAGCTGTGACAAGG + Intergenic
1131933486 15:97473874-97473896 CAGGCATAACAAAGGTGACAGGG - Intergenic
1134215344 16:12312914-12312936 GTGGCTTGCCAGAGGTGGGATGG + Intronic
1134889513 16:17827009-17827031 CTGGCTTGAAAGAAGTAACTAGG - Intergenic
1135889708 16:26346167-26346189 TTGGCTTGGCAGAGCTGCCAGGG + Intergenic
1136113755 16:28081545-28081567 CTGAAGTGACAGAGGAGACACGG - Intergenic
1139668128 16:68472508-68472530 CAGCCTGGACACAGGTGACATGG + Intergenic
1140707390 16:77643404-77643426 CTGGCCTTAAAGAGCTGACAAGG + Intergenic
1141172214 16:81698444-81698466 CGGGCTTGGCAGAGGTGGCTGGG + Intronic
1141427999 16:83956037-83956059 CCTGCAAGACAGAGGTGACAGGG + Intronic
1141690299 16:85592958-85592980 CTGGCTGAACAGAGGTGGCGGGG - Intergenic
1143019928 17:3912050-3912072 CTGTCTTCACAGTGGTGAAACGG - Intronic
1146085082 17:29820866-29820888 CTGGGAAGAGAGAGGTGACAAGG - Intronic
1149548039 17:57518876-57518898 CAGGCTTGACAGCTGTCACATGG - Intronic
1150204403 17:63391238-63391260 CAGGTTTGGCAGAGGTGAAAGGG - Intronic
1150639672 17:66940943-66940965 CTTGCCTCCCAGAGGTGACAAGG + Intergenic
1154043117 18:10878023-10878045 AGGGCTTCACAGAGGAGACATGG - Intronic
1154957971 18:21277710-21277732 ATGGCATGACAGGGGTGACAGGG - Intronic
1156878184 18:42042124-42042146 CTTGCTTGACAGAGGTTGCCTGG + Intronic
1157560164 18:48640013-48640035 CCTGCATGACAGGGGTGACAAGG - Intronic
1158435227 18:57430641-57430663 CAGGCTTGAGAGAGGGGAAAGGG - Intergenic
1158700711 18:59743363-59743385 CGGCCTTGACAGAGGTGAGAGGG - Intergenic
1159435709 18:68414402-68414424 CTGTAGTGACAGAGGTAACAAGG + Intergenic
1160071887 18:75636193-75636215 CTGGGATGACAGAGGTGGGAAGG + Intergenic
1160710935 19:550685-550707 CTGGGGTGACAGTGGGGACAGGG - Intergenic
1160711000 19:550897-550919 CTGGGGTGACAGTGGGGACAGGG - Intergenic
1161052067 19:2169409-2169431 CTGGCCTGAAAGAGGTTGCAGGG + Intronic
1162022915 19:7876030-7876052 CTTGGCCGACAGAGGTGACAAGG - Intergenic
1166339695 19:42130240-42130262 CTGGCTGGACTGATGTGACTTGG - Intronic
1167522745 19:49965686-49965708 CCGCCTTGACAGAGGTGGCTGGG + Intergenic
1168461225 19:56560298-56560320 ATTGCTTAACAGAAGTGACACGG - Intergenic
927102793 2:19800710-19800732 GTGGCTTGCCAGAGGTCACATGG - Intergenic
927851232 2:26500979-26501001 CTGGCTGCTCAGAGGGGACAGGG - Intronic
933333437 2:80923827-80923849 CTGGCTTTATAGAGGTCATATGG + Intergenic
933983933 2:87575263-87575285 CTGGGTGGAGAGGGGTGACAAGG - Intergenic
936309922 2:111375533-111375555 CTGGGTGGAGAGGGGTGACAAGG + Intergenic
936885665 2:117308204-117308226 CAGCCTTGACAGAGGTGGCTGGG + Intergenic
937937939 2:127261018-127261040 CTGGCAGGACTGAGGTGCCATGG - Intronic
939505491 2:143041090-143041112 CTTTTTTGACAGAAGTGACAAGG - Intronic
942539181 2:176997524-176997546 CTGTGTTGACAGTGGGGACAAGG + Intergenic
943171037 2:184400539-184400561 CTGGTTTGACAGAGTTGACTGGG + Intergenic
944201281 2:197109955-197109977 CAGGCTTGACAGAGAAGACCTGG - Intronic
945213019 2:207403282-207403304 CTTGCTTGACTATGGTGACAGGG - Intergenic
946070757 2:217032524-217032546 CTGGCTTCAGAGTGTTGACATGG + Intergenic
946586852 2:221199068-221199090 CTGGCCTGACAGAGCTGAGAAGG + Intergenic
947369315 2:229428296-229428318 CTGGGATGAGAGTGGTGACAGGG + Intronic
947851928 2:233295181-233295203 CAGGCTTGGCAGAGGGGCCATGG - Exonic
948597015 2:239086628-239086650 CTGACTTCCCAGGGGTGACAGGG + Intronic
1169131085 20:3166710-3166732 CTAGCTTGCCAGAGGTGGCCAGG + Exonic
1171072551 20:22088616-22088638 CTAGCACAACAGAGGTGACAGGG - Intergenic
1172474117 20:35224796-35224818 CTGGCTTGAAGGAGGTGACAAGG - Intergenic
1173603177 20:44310584-44310606 CAGGCAGGACAGAGGTGAGATGG + Intronic
1174434263 20:50494456-50494478 CTGGCTTGAACTGGGTGACATGG - Intergenic
1175215076 20:57388037-57388059 CAGGCTGGGCAGAGGTGACTTGG - Intergenic
1175458271 20:59131449-59131471 CTGACTTGACAGAGGGGAGGTGG + Intergenic
1176263088 20:64193477-64193499 ATGGCTTCACAGCAGTGACAGGG + Intronic
1179115738 21:38490487-38490509 GTGGCTTGCCAAAGGTGAAATGG + Intronic
1180015671 21:45081641-45081663 TTGGCATGACCGAGGAGACAGGG + Intronic
1181962247 22:26630576-26630598 CTGGGTTCACACAGGTTACAGGG - Exonic
1182675459 22:32035783-32035805 CTGGCTTCAGAGAGGAGCCATGG - Intergenic
1182763572 22:32742452-32742474 CTGGCTTGGCAGTGGAGGCAAGG + Intronic
1184646127 22:45896458-45896480 CTGGCTTGCCAGAGACCACAAGG + Intergenic
1185121684 22:48975171-48975193 CTGGCTGGACCAAGGTGCCAGGG - Intergenic
1185219795 22:49623610-49623632 CTGGCTTGACACACTTGACCAGG - Intronic
953039651 3:39244194-39244216 CTGTCATAACAGAGCTGACAAGG - Intergenic
953140670 3:40226646-40226668 GAGGCTTAAGAGAGGTGACAAGG - Intronic
953261983 3:41348481-41348503 CTGGCTTTACAGAGGAGGGATGG + Intronic
953348576 3:42197130-42197152 CTGGATTGCCAGAGGGGAGAGGG + Intronic
954744139 3:52777575-52777597 CTGGTCTGACTGAGGTGACAGGG + Exonic
956826265 3:72999454-72999476 TTGGCTTGACATTGTTGACAGGG - Intronic
958824828 3:99017641-99017663 AGAGCTTGAGAGAGGTGACAAGG - Intergenic
963206548 3:142642123-142642145 CAGGTTAGACAGAGGTGACAAGG - Intronic
964564246 3:158032369-158032391 CAGCCTTGACAGAGGTGACTGGG - Intergenic
967046948 3:185746218-185746240 CTGGCTTGACAAATTTGACTTGG + Intronic
967875889 3:194268250-194268272 CTGCCTTGATGGAGGTGACGTGG - Intergenic
967875909 3:194268328-194268350 CTGCCTTGATGGAGGTGACGCGG - Intergenic
967875919 3:194268367-194268389 CTGCCTTGATGGAGGTGACGCGG - Intergenic
969275911 4:6135690-6135712 CTGGTTTGTCATAGGTAACATGG - Intronic
969993944 4:11292566-11292588 CTGGCTTCAGAGATGGGACAAGG - Intergenic
970768127 4:19576244-19576266 CTGAATTGTCATAGGTGACAAGG + Intergenic
971909279 4:32774311-32774333 ATGGTTTGTCAGAGATGACATGG - Intergenic
972563473 4:40248963-40248985 ATGACATGACAGAGGGGACAGGG + Intergenic
975375030 4:73633017-73633039 CAGCCTTGACAGAGGTGTCTGGG - Intergenic
977624815 4:99179009-99179031 CAGACTTGACAGATGTGACTGGG + Intergenic
978937009 4:114389647-114389669 CCTGCATGACAGAGGTGGCAGGG + Intergenic
979601119 4:122587574-122587596 CTGACTGGACAGAGATGGCAAGG - Intergenic
981139619 4:141253529-141253551 CAGCCTTGACAGAGGTGATTGGG + Intergenic
981632679 4:146838976-146838998 CTGGCTGGACAGAGGGGTCAGGG - Intronic
981714168 4:147736602-147736624 CTGGATTGTCAGAGGGGAAAAGG - Intronic
983739974 4:171118055-171118077 CTGGAAAGACAGATGTGACATGG + Intergenic
984439946 4:179755527-179755549 CTGGCAGGCAAGAGGTGACAAGG - Intergenic
984882737 4:184424853-184424875 CTGGCTTGGCAGTTGTCACATGG - Intronic
985073930 4:186193985-186194007 CTGGTCTGACAGAGGGGACAGGG - Intronic
985119266 4:186623403-186623425 CTGGCCTGACACAGGAGACTGGG + Intronic
985817350 5:2136755-2136777 GTGCCTGGACAGAGGTGACCAGG + Intergenic
985817399 5:2136971-2136993 GTGGGTGGACAGAGGTGACTAGG + Intergenic
985817412 5:2137036-2137058 GTGGGTGGACAGAGGTGACCAGG + Intergenic
986466354 5:8028865-8028887 CTGGCTTCACAGAGATGAGTTGG + Intergenic
986808293 5:11329557-11329579 CTGGCTTAAGAGAGGTGTTATGG - Intronic
995165118 5:109030776-109030798 CTCCCTTGCCAGAGATGACAGGG - Intronic
997972799 5:138417674-138417696 CTGGCATAACAGAGTTGAAAAGG - Intronic
998729799 5:145061889-145061911 CTGGCATGGCAGAGGTGATCAGG + Intergenic
999385552 5:151151564-151151586 CTGGCTTGCCTGAGGTTACATGG - Intronic
1001494383 5:172177716-172177738 CTGGTTTGAATGAGGTGACTAGG + Intronic
1004285995 6:14321443-14321465 CTAGCTTGAAAGAGGTGAACAGG - Intergenic
1004553559 6:16673463-16673485 CTGCCTTGACAAAGGTGAGGAGG - Intronic
1006361526 6:33589779-33589801 CTGGCTTCCCAGAGATGAGATGG + Intergenic
1007823459 6:44579517-44579539 GTGGCTTGTCTGAGGTCACACGG + Intergenic
1008882599 6:56395661-56395683 CAGCCTTGACAGAGGTGGCTGGG - Intergenic
1014027225 6:116662800-116662822 CAGGTTTGACAGTGGTGAAAGGG - Intronic
1015525540 6:134172505-134172527 CTGGCTTGACTTAAGTGCCAAGG - Intronic
1016118609 6:140319398-140319420 CTATCTTGGCAGAAGTGACATGG - Intergenic
1016240678 6:141926311-141926333 CTGACATGACAGAGGTAAGAAGG - Intergenic
1016640955 6:146348778-146348800 CAGGCTTGACAATGGTGCCAGGG + Intronic
1017037686 6:150281136-150281158 CTGGCTGTACAGAGATCACATGG - Intergenic
1018604530 6:165583646-165583668 CTGGCTTGACAGAAAAGAAAAGG + Intronic
1024209995 7:47194850-47194872 CTGGCGTGACAGAGGAGGGATGG + Intergenic
1024893378 7:54227783-54227805 CAGCCTTGACAGAGGTGGCTAGG - Intergenic
1024900540 7:54314604-54314626 CAGCCTTGACAGAGGTGGCTAGG + Intergenic
1026023043 7:66725716-66725738 CTGGTATGACAGAGAGGACATGG + Intronic
1028133329 7:87202608-87202630 CTGACTTGCCAAAGGTCACACGG + Intronic
1031526676 7:122830097-122830119 CTGGCTTGCCCAAGGTGACACGG + Intronic
1033179328 7:139159646-139159668 CTGGCTTAACAGAGGATAGATGG - Intronic
1035132569 7:156669463-156669485 CTGCCTGGACAGAGGTTCCAGGG - Intronic
1038311956 8:26451561-26451583 CTGGCATGGCTGAAGTGACATGG + Intronic
1045370288 8:101515981-101516003 GTAGCTTGTCAGAGGTCACAGGG + Intronic
1045492800 8:102682978-102683000 TTGACTTGTCACAGGTGACATGG - Intergenic
1046889137 8:119401756-119401778 CTTAATTTACAGAGGTGACATGG - Intergenic
1048025066 8:130578503-130578525 CTGGCTTGGCAGAGGGACCAGGG + Intergenic
1048732353 8:137457250-137457272 TTGGCCTGACATAGGTGAAAGGG - Intergenic
1048754770 8:137726909-137726931 CTGTATTGACACTGGTGACATGG + Intergenic
1049503130 8:142978725-142978747 CTGGAGAGACAGAGGGGACATGG + Intergenic
1049919435 9:349600-349622 CTCACTTGATAGGGGTGACATGG + Intronic
1054928579 9:70613305-70613327 CTGGCTAGACACAGATGTCAAGG + Intronic
1055868948 9:80850956-80850978 CTGGAGAGACAGAGGTTACATGG + Intergenic
1056732391 9:89177818-89177840 CTCGCTTGACAGCGGTGAGGAGG - Intronic
1057286214 9:93756721-93756743 CAGCCTTGACAGAGGTGGCTGGG + Intergenic
1057577970 9:96259149-96259171 ATGGCTTCACACAGGTGTCAAGG + Intronic
1059904308 9:118964748-118964770 ATGGCTGGAGAGAGGTTACAAGG - Intergenic
1062139134 9:134945768-134945790 CTGCATGGGCAGAGGTGACAGGG - Intergenic
1062394763 9:136348317-136348339 GTGGCCTCACAGAGGTGACCAGG + Intronic
1062652750 9:137586695-137586717 CTGGCATGACAGTGGGGAGAAGG - Intronic
1186725332 X:12351655-12351677 CTGGCTGGATAGTGGTGCCAAGG - Intronic
1191743769 X:64464176-64464198 TTGGCTTGTCTGAGGCGACAAGG - Intergenic
1192021969 X:67403329-67403351 CTGGTTTGATGGAGGTGGCAGGG + Intergenic
1192682717 X:73268342-73268364 CTGGCTTGGCAGAGGTGTTGAGG + Intergenic
1194774005 X:97940960-97940982 CTTCCTTGACAAAGGTGATAAGG + Intergenic
1201792396 Y:17856715-17856737 CTGGCTGGACAGAGTTGAGGAGG - Intergenic
1201809158 Y:18049271-18049293 CTGGCTGGACAGAGTTGAGGAGG + Intergenic
1202353933 Y:24025963-24025985 CTGGCTGGACAGAGTTGAGGAGG - Intergenic
1202516846 Y:25644149-25644171 CTGGCTGGACAGAGTTGAGGAGG + Intergenic