ID: 1129815304

View in Genome Browser
Species Human (GRCh38)
Location 15:78547448-78547470
Sequence TAGATTAAGAAGAACAGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 373
Summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 340}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129815304 Original CRISPR TAGATTAAGAAGAACAGGAG AGG (reversed) Intronic
900267716 1:1767486-1767508 AAGCTTCAGAAGAACAGAAGAGG + Intronic
900912990 1:5615283-5615305 AAGGATCAGAAGAACAGGAGAGG + Intergenic
901487301 1:9573515-9573537 TAGATTAAGGAAACGAGGAGGGG - Intronic
901538806 1:9901373-9901395 TTGATCAGGAAGAACAGGGGTGG + Intronic
903099395 1:21015066-21015088 TAGTTTAAAAAAAAAAGGAGGGG + Intronic
904103508 1:28055241-28055263 TAGAGTATAAAGAACAGCAGTGG - Intronic
904359943 1:29964776-29964798 TTGATGGAGAAGTACAGGAGTGG + Intergenic
904449711 1:30602966-30602988 TTGATTAAAAAAAAAAGGAGGGG + Intergenic
904461264 1:30681407-30681429 AAGAAGAAGAAGAAGAGGAGTGG + Intergenic
906383217 1:45345905-45345927 TACAGGAAGAAGAGCAGGAGAGG - Exonic
907148274 1:52256904-52256926 GAGAATAATAAAAACAGGAGAGG - Intronic
909148924 1:71975413-71975435 TAGATTAGGAAGGACATGATAGG + Intronic
909227324 1:73042368-73042390 TAGATAAATTAGAAAAGGAGAGG - Intergenic
909472149 1:76040905-76040927 TTAATTAAAAACAACAGGAGTGG - Intergenic
909562551 1:77022822-77022844 TAGAGGAAGAAAGACAGGAGGGG - Intronic
910247395 1:85154440-85154462 TAGAATAAGAAGGCCAGAAGAGG - Intergenic
911086207 1:93979468-93979490 TTAATTAAAAAGAACAGCAGAGG - Intergenic
911868968 1:103066865-103066887 TAGGTTAACAAGAAAAGGAGTGG + Intronic
912133375 1:106629284-106629306 TAGACAAAGAAGCAGAGGAGTGG + Intergenic
913521797 1:119651638-119651660 TAGGTTAAGAAAAACAACAGAGG - Intergenic
914214417 1:145611880-145611902 TAGATCAAGCAGAAAAGGAAAGG - Intronic
914466356 1:147932274-147932296 TAGATCAAGCAGAAAAGGAAAGG - Intronic
915292367 1:154895017-154895039 AAAATTAAGAAGAATTGGAGTGG + Intergenic
916304481 1:163313858-163313880 GAGATTAGGAAGCACAGTAGAGG + Intronic
916609239 1:166374064-166374086 TAGATTAAGAAAAGCAGAATAGG - Intergenic
916706604 1:167357215-167357237 AAGATTAAGAAGAAGATAAGGGG - Intronic
918191860 1:182183399-182183421 CAGATGAAGAAGAAGAGGAAGGG - Intergenic
919208224 1:194445685-194445707 TTGACAAAGAAGAACAAGAGTGG - Intergenic
919595829 1:199561451-199561473 AAGAGGAAGAAGAACAGGCGGGG - Intergenic
921685057 1:218080560-218080582 TAGATAAAGAAGAATAAGAAAGG + Intergenic
921934476 1:220784415-220784437 TAGAGTAAAAAGCACATGAGTGG - Exonic
923227315 1:231950070-231950092 TAGCTTAAGAAGATCAAGTGTGG + Intronic
923310734 1:232732302-232732324 TAGATTAAAATAAACAAGAGGGG - Intergenic
923910353 1:238434573-238434595 TGCATTTATAAGAACAGGAGAGG - Intergenic
923968322 1:239169626-239169648 TAGCTTAAGAAGAAAAGCTGTGG + Intergenic
924770332 1:247074393-247074415 TAGATTAGAAAAAAGAGGAGAGG - Intronic
1063287351 10:4705011-4705033 TAGATGGAGAAGAGGAGGAGGGG + Intergenic
1064200304 10:13278827-13278849 TCGGTTAAGTAGACCAGGAGTGG - Intronic
1064398072 10:14997112-14997134 TAGATTACGAAGAATATGAAAGG - Intergenic
1066192551 10:33069338-33069360 CAGAACAAGAAGAAAAGGAGAGG - Intergenic
1066303238 10:34115294-34115316 AAGATGAAGAAGAAATGGAGAGG + Intronic
1067455267 10:46414621-46414643 TGTCTTAGGAAGAACAGGAGAGG - Intergenic
1067631936 10:47970013-47970035 TGTCTTAGGAAGAACAGGAGAGG + Intergenic
1068199028 10:53758855-53758877 ATGATTAAGGAGGACAGGAGAGG + Intergenic
1068398909 10:56503076-56503098 TAGATTATGCTGAACAGGAGTGG + Intergenic
1068460916 10:57327183-57327205 AAGAAGAAGAAGAACAGGAGTGG - Intergenic
1068791702 10:61036941-61036963 TAGTTTAACTTGAACAGGAGAGG + Intergenic
1068873459 10:61970932-61970954 TAGATTGAGAAAAGGAGGAGGGG + Intronic
1069140862 10:64823504-64823526 AAGATAAGGAAGAAGAGGAGAGG + Intergenic
1071741741 10:88366386-88366408 TAGATTAGAGAGAACAGTAGAGG + Intronic
1072473715 10:95738060-95738082 AAGATGAAGGAGACCAGGAGAGG + Intronic
1072703475 10:97662141-97662163 AAGATTAAGAATATCAGCAGAGG - Intronic
1073772465 10:106750428-106750450 AAGATTAAGAAGTGGAGGAGGGG + Intronic
1074940282 10:118229808-118229830 TAAAGTAAAAAGAACAGAAGGGG - Intergenic
1078774693 11:14383282-14383304 TAGATTATGAACTCCAGGAGGGG + Intergenic
1079212581 11:18476234-18476256 TAGATTTAGAATATCTGGAGTGG + Intronic
1081133707 11:39411675-39411697 AAGAGGAAGAAGAAGAGGAGGGG + Intergenic
1081517093 11:43843637-43843659 TACAGTGAGAAGAACTGGAGAGG - Intronic
1082111657 11:48283389-48283411 AAACTTAAGATGAACAGGAGGGG - Intergenic
1082257295 11:50044942-50044964 TAGCATAAGAACAACAGGTGTGG - Intergenic
1083597359 11:63924550-63924572 TAGATCAGGAAGTAAAGGAGAGG - Intergenic
1084032566 11:66489469-66489491 TGGGTTCAGAGGAACAGGAGTGG + Intronic
1085502645 11:77037947-77037969 AAGAAGAAGAAGAAGAGGAGGGG + Intronic
1086190610 11:84074479-84074501 TATATTAAAGAAAACAGGAGTGG - Intronic
1086204840 11:84245438-84245460 TAGGTTATGAAGAATATGAGTGG - Intronic
1087236949 11:95730643-95730665 TACATTTGGAAGAACAGGATTGG - Intergenic
1087244556 11:95818855-95818877 TCCATGAAGAAGAACAGGAAAGG + Exonic
1088372443 11:109106577-109106599 TAGAAAAAGACTAACAGGAGGGG + Intergenic
1088654363 11:111985254-111985276 TACCTGAAGATGAACAGGAGAGG + Intronic
1090255824 11:125283435-125283457 TAGATATTGAAGTACAGGAGAGG - Intronic
1091412692 12:254484-254506 TAGGTTAAGAAGATGAGGAAAGG - Intronic
1092294179 12:7185103-7185125 TAGTTTAAGTTGAACAGGACAGG - Intergenic
1092391093 12:8080090-8080112 AACATGAAGAAGAACAGGTGAGG + Intergenic
1092625919 12:10328530-10328552 TAGACTAAGAAAAAGAAGAGAGG - Intergenic
1093205959 12:16249714-16249736 TAGATTAAGAAGCAAATGAATGG + Intronic
1093442400 12:19214220-19214242 GAGATTAGGAAAACCAGGAGAGG + Intronic
1094494495 12:30980902-30980924 TAGACAAAGAGGAACAGGACAGG + Intronic
1097012251 12:55961522-55961544 TAGCTTGGGAAGAAAAGGAGGGG - Intronic
1097271904 12:57780652-57780674 GAGATTGAGAAGAACAGCAAGGG - Exonic
1097972536 12:65649932-65649954 TAAAATGATAAGAACAGGAGTGG + Intergenic
1098339813 12:69440257-69440279 TTGATCAAGCAGAACATGAGTGG + Intergenic
1098899688 12:76100283-76100305 TAAATTAAGAAGAAAATAAGAGG + Intergenic
1099029415 12:77506725-77506747 TAGATTAAAAAGAACCCAAGAGG - Intergenic
1099370433 12:81822860-81822882 GAGATTAAGGAAAACAGGATTGG + Intergenic
1100288687 12:93192535-93192557 TGGATTAAGAAGAAAAGTGGTGG + Intergenic
1100402191 12:94241994-94242016 AAGAAGAAGAAGAAAAGGAGGGG + Intronic
1100936118 12:99668748-99668770 GAGATTCAGAAGGAGAGGAGGGG - Intronic
1101072973 12:101096172-101096194 TAGATTAAGAGGAAAAGAAAAGG + Intronic
1101667830 12:106835974-106835996 TGGATTCAAAAGAACAGTAGAGG - Intronic
1103313819 12:120035033-120035055 CAGAGTAAGAATAAAAGGAGAGG + Intronic
1104324886 12:127786396-127786418 GAGACAAAGAAGTACAGGAGTGG + Intergenic
1105425508 13:20291618-20291640 AAGATGAAGAAGTTCAGGAGAGG - Intergenic
1107100878 13:36589874-36589896 TAAATTAAGAAAAAGAGGAGCGG - Intergenic
1108870609 13:54979928-54979950 TAGAGTAAGGAGAAAAGGAGGGG + Intergenic
1109048135 13:57439684-57439706 AAGATTAAAAAGAAGTGGAGAGG + Intergenic
1109109737 13:58301500-58301522 TAGATTGAGAGAAACAGAAGTGG + Intergenic
1110291059 13:73806903-73806925 GAGATTAACAAAAACAGGAGGGG + Intronic
1110380098 13:74840552-74840574 TCGACTAAGAAGAAGAGGTGGGG - Intergenic
1110592211 13:77276378-77276400 TAGATTAAAAAAAGGAGGAGAGG + Intronic
1110935273 13:81279755-81279777 AAGAGGAAGAAGAAAAGGAGGGG - Intergenic
1111891520 13:94088523-94088545 TATATTAAAAAGAAAAAGAGAGG + Intronic
1112214709 13:97418358-97418380 TTGATGAAAAAGATCAGGAGAGG - Intergenic
1112947010 13:104941467-104941489 TAGATTAGGAAGAAGAAAAGAGG + Intergenic
1114974091 14:28072724-28072746 TAGAGTAAGAAGAATAGATGAGG + Intergenic
1116270419 14:42757982-42758004 TAGATTCAGAATAAAAGGAGTGG - Intergenic
1116688761 14:48077906-48077928 TAGAGTAAGAAGAAAAGGTGGGG - Intergenic
1116928457 14:50667144-50667166 TACATTAAGAAGAAAAGCAGCGG + Intronic
1118680342 14:68235342-68235364 TAGATCAAGCAGAAGAGGAGGGG + Intronic
1119862379 14:77945760-77945782 GAGATTAAGAAGAACAGAGCGGG - Intergenic
1120003178 14:79327031-79327053 AAGATTAAGAAGAAAAGCAAGGG - Intronic
1120491485 14:85184030-85184052 TAGTTTAAGAAGAAAAGGGTTGG + Intergenic
1121485413 14:94310730-94310752 TAAGTTCAGAAGAACAGAAGAGG - Intronic
1122621340 14:103059008-103059030 AAGAAGAAGAAGAAGAGGAGTGG + Intergenic
1124589089 15:31037137-31037159 TCTACTAACAAGAACAGGAGAGG - Intronic
1125353895 15:38796143-38796165 TAGATGAATGAGAAAAGGAGAGG - Intergenic
1126325053 15:47467556-47467578 TAGATTGAGAAGTAGAGGAAGGG + Intronic
1126795208 15:52254679-52254701 AAGAGGAAGAAGAACAGGAGAGG + Intronic
1128677657 15:69623758-69623780 TAGATTAACTAGAACTGCAGAGG + Intergenic
1128735102 15:70049111-70049133 AAGATTCAGAAGAGCTGGAGAGG + Exonic
1129018213 15:72488466-72488488 TAGATAAGGAAGCACAGGAAAGG - Intronic
1129268069 15:74404836-74404858 AAGTTAAAGAAGACCAGGAGCGG + Intergenic
1129815304 15:78547448-78547470 TAGATTAAGAAGAACAGGAGAGG - Intronic
1131999883 15:98167879-98167901 TACGTTAAGAAGATCAGAAGTGG - Intergenic
1132410100 15:101571096-101571118 TAGATTAATAAAAACAGGCAAGG + Intergenic
1133037600 16:3042873-3042895 TAGACTAAGAAGACCTAGAGGGG - Intergenic
1133139908 16:3736075-3736097 TAGAACAAGAAGAAGAGGAGAGG - Exonic
1133893453 16:9903266-9903288 TGGATTAAGAAAACCAAGAGAGG - Intronic
1134607786 16:15584684-15584706 GAGAAAAAGAAGAAAAGGAGGGG - Intronic
1135270479 16:21065474-21065496 TTAATTAGGAATAACAGGAGTGG + Intronic
1135857771 16:26027970-26027992 AAGATTAAAAAGAATAAGAGAGG + Intronic
1135881200 16:26259329-26259351 TAGCTTAAGAAGAGGAGGACTGG + Intergenic
1136548936 16:30971549-30971571 AAGATGAAGAGGAAGAGGAGCGG + Exonic
1137023374 16:35451781-35451803 TTGAGGAAGAAGAAAAGGAGTGG - Intergenic
1137036620 16:35574480-35574502 TAGAACCAGAAAAACAGGAGAGG - Intergenic
1138102515 16:54265100-54265122 TAGATTAATAAGAACAGGTTTGG - Intronic
1139273534 16:65705739-65705761 TGGACTGAGAAGAACATGAGGGG - Intergenic
1140969321 16:79997738-79997760 TTGATAAACAAGAGCAGGAGAGG - Intergenic
1141148397 16:81547746-81547768 AAGATGAAGAAGAATTGGAGAGG + Intronic
1143264167 17:5623311-5623333 GAGATCTAGAAGAAGAGGAGTGG + Intergenic
1143794870 17:9328329-9328351 AAGAAAAAGAAGAGCAGGAGAGG + Intronic
1144415937 17:15046493-15046515 TATATTAAGAAAAACAGGCCAGG - Intergenic
1147498831 17:40942627-40942649 AAGAAGAAGAAGAAGAGGAGGGG - Intergenic
1148549637 17:48542909-48542931 TAGAAGAAGAAGAAAGGGAGTGG + Exonic
1149056678 17:52375217-52375239 TGGATTAAAAAGAACAGGAAAGG - Intergenic
1149696980 17:58623790-58623812 AAGATGAAGAAGAGGAGGAGGGG + Intronic
1150964159 17:69948422-69948444 AAGAAGAAGAAGAAGAGGAGGGG + Intergenic
1153268215 18:3293012-3293034 TAATTGAAGAAGAAAAGGAGAGG + Intergenic
1154106701 18:11529747-11529769 TAGATAAAGAAGAGCGGCAGAGG - Intergenic
1154467655 18:14664974-14664996 TAAATTTAGAAGAGGAGGAGAGG + Intergenic
1155690443 18:28615658-28615680 TGGATTAAGCTGAACAGGAGCGG - Intergenic
1155698378 18:28712115-28712137 TGGATTAATAATTACAGGAGAGG + Intergenic
1156378912 18:36539770-36539792 TAGAGTAGGAAGTACAGGATTGG + Intronic
1156629855 18:38953978-38954000 TAGTTTAATAAGAATAGTAGGGG - Intergenic
1156738369 18:40292346-40292368 TTTAATAAGAAGAAAAGGAGAGG - Intergenic
1157076947 18:44476777-44476799 TAGATAAATAAAAGCAGGAGAGG - Intergenic
1157209482 18:45729327-45729349 TAGATAAAAAAGAATAGCAGTGG - Intronic
1157487386 18:48098134-48098156 TACAATAAGGAGAACATGAGAGG + Intronic
1158086540 18:53657772-53657794 GAGTTTAAGAAGAGCAGAAGAGG - Intergenic
1158699121 18:59730754-59730776 TAGCATAAGAACAACAGGTGTGG + Intergenic
1159030197 18:63223103-63223125 TAAAATAAGAAGAACAGGGCAGG + Intronic
1160239349 18:77112000-77112022 TAGAATAAGAGGAAGAGGAATGG - Intronic
1161789110 19:6348167-6348189 TGGATAAAGAAGAACAGGCTGGG + Intergenic
1164302431 19:23973561-23973583 AAGAGTAAAAAGAAGAGGAGAGG + Intergenic
1164499282 19:28801161-28801183 TAGATTAAGAAAAAAAAGAGAGG + Intergenic
1165556082 19:36633434-36633456 TAGATTCAGGAGTACAGGTGTGG + Intergenic
1165761725 19:38325693-38325715 TGGATGAAGAAGACCTGGAGAGG + Intronic
1166064981 19:40352405-40352427 CAGATGATGAACAACAGGAGAGG + Intronic
1167807327 19:51797253-51797275 TGGATTAAGGAGAACAGCTGAGG + Intronic
925142279 2:1558564-1558586 TTGTTTAAGAAGATCAGAAGGGG - Intergenic
926788046 2:16538152-16538174 TATGTTTAGAAGAACAGGAAGGG - Intergenic
927934187 2:27066499-27066521 AAGAGTAAGTAGAGCAGGAGAGG + Intronic
927994854 2:27477356-27477378 TACATGAAGAAAAACAGTAGTGG + Intronic
928905834 2:36366533-36366555 AAGATTAAAAAAAAAAGGAGAGG + Intronic
929019958 2:37542890-37542912 TAGATTAAGAAGAACATAATAGG - Intergenic
929225375 2:39506871-39506893 TTGATCAAGAAGACCAGGAAAGG - Intergenic
933330487 2:80887168-80887190 TAGAAGCAGAAGAAGAGGAGGGG - Intergenic
935172596 2:100622055-100622077 AAGAAGAAGAAGAACAGGAATGG - Intergenic
936175993 2:110220373-110220395 AAGAGTTAGAAGAATAGGAGTGG + Intergenic
936467972 2:112770772-112770794 TGGAATAAGAAAAACATGAGTGG - Intergenic
936645797 2:114368967-114368989 CAGATTAAGAAGGAGAGAAGGGG - Intergenic
937176499 2:119941691-119941713 TAGATTAAGATGAAGACGAAAGG - Intronic
938135473 2:128753122-128753144 TAGATTAACAAAAACAACAGGGG - Intergenic
938976456 2:136482857-136482879 AAGATTAAGAAGAGCAGAAAGGG - Intergenic
940820200 2:158345320-158345342 TAGATTTAGAGGAACAAAAGAGG + Intronic
941702633 2:168620483-168620505 TAAATTAACATGAACAGGAATGG - Intronic
942260065 2:174150917-174150939 TAGGTTAAGAAGAAGAAGAAAGG + Intronic
942933519 2:181526006-181526028 TAGATTTAGAGCAACAGGAAAGG - Intronic
943091441 2:183380145-183380167 TAGATTAATAATAAGAGGACTGG - Intergenic
944069051 2:195649810-195649832 AAGATGAAGAAAAACAGGTGTGG - Intronic
944939828 2:204611559-204611581 GAGATGAGGAAGAACAGGAGAGG - Intronic
947357784 2:229314994-229315016 TAGATTCAGAAGAACATGTCTGG - Intergenic
947925479 2:233918476-233918498 TAGAATAAGAGGAAAAGCAGGGG - Intronic
1169506633 20:6218657-6218679 TTTATTAATAAGAAAAGGAGGGG + Intergenic
1170115187 20:12850249-12850271 TAGATTCAGAATAACAAGAGTGG - Intergenic
1171105701 20:22430483-22430505 TTGATTAAAAGGAAGAGGAGAGG + Intergenic
1171456889 20:25277225-25277247 TTGACTAAGAAGAAATGGAGCGG - Exonic
1172572928 20:35984441-35984463 CAGATTAAGAAGAAGGGGAGTGG + Intronic
1173015446 20:39221104-39221126 TAGGGAAAGAAGAACAGGGGAGG + Intergenic
1174508898 20:51036326-51036348 TAGAGGAAAAAGAACATGAGGGG - Intergenic
1177177553 21:17716453-17716475 TAGACTAAGAAAAAAAGAAGAGG + Intergenic
1177809244 21:25907134-25907156 TAGAAGAAGAAGAAGAAGAGCGG - Intronic
1181260551 22:21594099-21594121 TGGATGAGGAAGAACAGGAAAGG - Intronic
1181321567 22:22011062-22011084 TAGATTAAAAAGAAAAAGCGAGG + Intergenic
1182150993 22:28027005-28027027 AAGACGAAGAAGAACAGGACAGG - Intronic
1182198419 22:28543457-28543479 GAGATGAACAACAACAGGAGGGG + Intronic
1182564253 22:31185480-31185502 TAGGTTAAGATGACCTGGAGAGG + Intronic
1183290497 22:36999155-36999177 CAGATTAAGAACAAGAGGTGGGG + Intronic
1184041928 22:41949494-41949516 TGGAGTAAGAAGAACAGGGGAGG + Intergenic
951200566 3:19872219-19872241 TAGTTTAACTAGAACAGGACAGG + Intergenic
953490869 3:43349125-43349147 TAGCTTAAGACAAACAGGTGTGG - Exonic
954817307 3:53292720-53292742 TGGATTCAGAAGAAATGGAGAGG - Exonic
956253344 3:67257461-67257483 TTGATTAAGAAGAACAAAGGTGG - Intergenic
957859867 3:85933014-85933036 TAGTTTAAGCAGTACAGGAGAGG - Intronic
959992411 3:112643963-112643985 AAGAATAAAAAGAAAAGGAGGGG + Intronic
962062360 3:131943631-131943653 TTGATTAAGAAGCACATTAGAGG - Intronic
962870994 3:139492777-139492799 TACATTAAGTAGAACAGGATTGG - Intergenic
963492163 3:146015685-146015707 AAGAGGGAGAAGAACAGGAGGGG - Intergenic
963956505 3:151260296-151260318 TAGATTAAGAAGGAAATGAGAGG - Intronic
964286860 3:155127321-155127343 TAGACTAAGAAAAACACCAGAGG - Intronic
964911752 3:161791107-161791129 TAGATAAAAAAGAAAATGAGAGG + Intergenic
965329444 3:167352244-167352266 TAGATTAAGAAAAATGAGAGAGG + Intronic
966057408 3:175712444-175712466 AAGTTTAAAAAGAACAGGTGAGG + Intronic
968200198 3:196746514-196746536 TAGATTAATAAGAATAGGCCGGG + Intronic
970277712 4:14419871-14419893 TAGATGAAGTTGAGCAGGAGAGG - Intergenic
970720580 4:18984037-18984059 TAGATTATAAAGCACAGGCGTGG + Intergenic
970903288 4:21185340-21185362 AAGATAAAGAAGAAAAGGAGGGG - Intronic
971556764 4:28022195-28022217 TATATTAATAAATACAGGAGTGG - Intergenic
972571617 4:40316429-40316451 TAGTTTCAGAAACACAGGAGTGG + Intergenic
973258988 4:48142007-48142029 TAGTTTAATAAGAACAGGTCTGG - Intronic
975162446 4:71139343-71139365 TGGATGAAGAGGACCAGGAGTGG - Intergenic
975258670 4:72270453-72270475 TAGATTGAGGAGGACAGGTGTGG + Intergenic
975664817 4:76725168-76725190 TAGATTAAGAACAAGATGACAGG - Intronic
977244134 4:94610130-94610152 TAGGGAAAGAAAAACAGGAGAGG - Intronic
977542549 4:98335140-98335162 GAGATTAATAAGAAAAGGAATGG - Intronic
981067146 4:140497782-140497804 TCGAGAAGGAAGAACAGGAGAGG + Intronic
984366206 4:178803184-178803206 TATCTTGAGAAGAATAGGAGAGG + Intergenic
984697019 4:182789310-182789332 TAGATTATGACGGACAGGGGAGG + Exonic
985311342 4:188603431-188603453 TTGAGTAGGAAGAAAAGGAGGGG - Intergenic
985422139 4:189795010-189795032 TACTTTAAGAAGTACAGGACTGG - Intergenic
986047505 5:4053528-4053550 TAAATTAAGAAGAAAAGTAGGGG - Intergenic
986278653 5:6304519-6304541 GAGAGAAAGAAGAAGAGGAGGGG + Intergenic
986762061 5:10889322-10889344 TACTTTAAGAATAATAGGAGTGG - Intergenic
986923876 5:12721999-12722021 TAAACTAAGAAAAACAGAAGTGG + Intergenic
989017149 5:36950967-36950989 AAGATTTTGAAGAACAGCAGAGG - Intronic
990183001 5:53183317-53183339 TGGATTTCAAAGAACAGGAGTGG - Intergenic
990269769 5:54124256-54124278 TAGAATAAGAAGAGCATGAAAGG - Intronic
992118354 5:73564853-73564875 AAAATTTTGAAGAACAGGAGAGG + Intronic
992413188 5:76527438-76527460 TGCATTCAGAAGAGCAGGAGAGG - Intronic
992987559 5:82248693-82248715 TAAATTAATAACAACAGAAGTGG - Intronic
993277871 5:85884943-85884965 TATATTAATAATAACAGGAAAGG + Intergenic
994845516 5:104984131-104984153 TAGACTAAAAAAAAAAGGAGGGG - Intergenic
996557102 5:124789741-124789763 TACATTAAGAAAAACATTAGAGG - Intergenic
997828667 5:137130219-137130241 AAGATTAAGAAGGATAAGAGTGG - Intronic
998611232 5:143691403-143691425 CTCATTAAGAAGAAAAGGAGGGG - Intergenic
999833793 5:155347285-155347307 TAGGTAAAGAAGAACAAGAGAGG - Intergenic
1000383822 5:160654735-160654757 CAGAATAATAATAACAGGAGAGG - Intronic
1001217806 5:169872131-169872153 GAGATGAAGAAGAAGTGGAGGGG - Intronic
1001383392 5:171318407-171318429 GAGACTAAGAAGAAGGGGAGGGG + Intergenic
1001547808 5:172581340-172581362 CAGATTTGGAAGAACAGGGGAGG - Intergenic
1003297269 6:4842521-4842543 TAGATAAAGAAGACAAAGAGGGG - Intronic
1004564801 6:16786268-16786290 AAGATGAAGAAGGACAGGTGCGG + Intergenic
1005220801 6:23586191-23586213 AAGAAGAAGAAGAGCAGGAGAGG - Intergenic
1005427792 6:25721708-25721730 AACATTTAGAAGAAAAGGAGTGG - Intergenic
1005909949 6:30300486-30300508 TAGACTAATAAAAAAAGGAGGGG - Intergenic
1007905057 6:45451296-45451318 TAGATGAAGAGCAATAGGAGTGG + Intronic
1008349776 6:50476385-50476407 TAGAATAAGTAAAATAGGAGTGG + Intergenic
1008527583 6:52421293-52421315 TAGAATAAAAAGAACAGGGCCGG - Intronic
1011017692 6:82775895-82775917 TTGATAAAGTAGAAGAGGAGGGG + Intergenic
1011195708 6:84777239-84777261 TAGATCAGCAAGTACAGGAGTGG + Intergenic
1011685067 6:89817480-89817502 AAGATTAAGAGGAAGAGGAAAGG + Intronic
1011800663 6:91011564-91011586 TAGAGAAAGTAGAACAAGAGGGG - Intergenic
1011937287 6:92796688-92796710 TAGATTAAAAAGTAAAGGAGGGG - Intergenic
1012071734 6:94628668-94628690 TATATGAAGAAGATCAGTAGTGG - Intergenic
1012633431 6:101503109-101503131 AAGTTTAAGAAGAAAGGGAGTGG + Intronic
1012866949 6:104629896-104629918 TAAATTATGAAGAACTCGAGTGG - Intergenic
1012990753 6:105923273-105923295 GAGATCAAGAAAGACAGGAGAGG + Intergenic
1013565128 6:111351210-111351232 TTGGTTAAGAAGGACAGGATGGG - Intronic
1013585838 6:111578060-111578082 TAGATCAAGAAGATCAGAACAGG + Intronic
1016241609 6:141938082-141938104 TAGATTAAGAAGAAAGAGATTGG + Intergenic
1016451957 6:144192421-144192443 TAGACTAAGAAAAATAGAAGAGG - Intergenic
1017602313 6:156097013-156097035 TGGCTTAAGAAGACAAGGAGAGG - Intergenic
1018404999 6:163470916-163470938 TAGTATTAGAAGAAGAGGAGAGG + Intronic
1018490020 6:164282816-164282838 TAGATTCAGAGGAAAAGCAGTGG - Intergenic
1018563871 6:165130850-165130872 GAGATTCAGGAGAACAGGGGCGG - Intergenic
1018761165 6:166895459-166895481 TAGTTTAACTAGAACAGGATGGG - Intronic
1019011848 6:168849311-168849333 AAGAAGAAGAAGAAGAGGAGTGG + Intergenic
1019781155 7:2940541-2940563 TAGAGGAAGAAGAAGAGGAAGGG + Intronic
1021680113 7:23121632-23121654 TAGCTTATTAATAACAGGAGGGG + Intronic
1022050992 7:26671620-26671642 TAGAATAACAATAGCAGGAGTGG - Intronic
1022118722 7:27286128-27286150 TACAGTCAGAAGAACAGGACAGG + Intergenic
1022153615 7:27636318-27636340 AAGATTAAAAAACACAGGAGTGG - Intronic
1022268654 7:28784505-28784527 CAGAGTGAGAAGACCAGGAGGGG - Intronic
1022636590 7:32142114-32142136 TAAATAAAGAGGAAAAGGAGAGG + Intronic
1024977892 7:55130721-55130743 TAAATGAAAAAGAACAGGGGTGG + Intronic
1026101464 7:67387914-67387936 TAGAGAAAGAGGAACTGGAGAGG + Intergenic
1027625376 7:80538093-80538115 TAGTTTCAGAAGAAAATGAGTGG - Intronic
1027663249 7:81012776-81012798 AAAATTAAGAAGAAAAGTAGAGG - Intergenic
1027866688 7:83657627-83657649 TAGATTCAGGAGAAAATGAGAGG - Intergenic
1030537124 7:110782303-110782325 TAAATTAAAAATAACAGTAGGGG + Intronic
1030719682 7:112855690-112855712 CAGATTTAGCAGAAGAGGAGGGG - Intronic
1030917366 7:115332267-115332289 TAGATTACAAAGAAGAGGACCGG - Intergenic
1031105867 7:117542250-117542272 TAGATTAAGAAGTAGAGGAATGG + Intronic
1031198337 7:118645045-118645067 GAGATTAAGAAGAGCAGGATGGG - Intergenic
1031236154 7:119180570-119180592 TAGCTGAAGAAGACCAAGAGTGG - Intergenic
1031750029 7:125560371-125560393 TTGAGTAGGAAGAATAGGAGAGG + Intergenic
1032838065 7:135691931-135691953 TAGATAAAGGAGAATAGAAGAGG + Intronic
1033567705 7:142595626-142595648 AAGATTGAGAAGGACAAGAGAGG - Intergenic
1033809457 7:144993899-144993921 TAGATTAATGAGAACTGGGGAGG + Intergenic
1034049190 7:147964108-147964130 TAGAGGAAGAAACACAGGAGAGG + Intronic
1035532275 8:362311-362333 TACATTAAGAGGAAGAGAAGAGG + Intergenic
1035684033 8:1509668-1509690 AAGAATGAGAAGAACAGGAGAGG - Intronic
1036286339 8:7447000-7447022 TGGATTAAAAAGGACAGTAGTGG + Intronic
1036335137 8:7864528-7864550 TGGATTAAAAAGGACAGTAGTGG - Intronic
1036983327 8:13496445-13496467 TGGAATTAAAAGAACAGGAGGGG - Intronic
1038436049 8:27536870-27536892 TGGGTGCAGAAGAACAGGAGGGG + Intronic
1039606383 8:38884156-38884178 TATATTAAGAAGAAAAGTTGGGG + Intergenic
1039854955 8:41404018-41404040 TAGTTTAAGAAGAGCAAGACTGG + Intergenic
1041323462 8:56638515-56638537 AAGAGTAAGAAGGCCAGGAGGGG - Intergenic
1042000325 8:64115719-64115741 TAGATCAAGAAAAAAAAGAGAGG + Intergenic
1044141892 8:88665866-88665888 AAGATTGGGATGAACAGGAGAGG + Intergenic
1044274292 8:90282604-90282626 TAGATTAAAAAAAACAGAAATGG + Intergenic
1045399277 8:101795708-101795730 TAATTTAAGAAGAAAAGCAGTGG - Intronic
1047120907 8:121903622-121903644 GAAATTAAGATGAAAAGGAGTGG + Intergenic
1047454566 8:124997856-124997878 TGCCTTAAGAAGAAAAGGAGAGG - Intergenic
1047557409 8:125947657-125947679 TAGCTTAAAAAAAAGAGGAGGGG + Intergenic
1047634026 8:126740234-126740256 TAGGTTAACAAGAAAAGAAGAGG - Intergenic
1047885420 8:129245082-129245104 TAGATCAAGAAATGCAGGAGAGG + Intergenic
1048592409 8:135833088-135833110 TACATTGATAAGGACAGGAGAGG - Intergenic
1049049161 8:140179919-140179941 TAGATTAAGTAGAAATGGATTGG - Intronic
1049049559 8:140183875-140183897 AAGAAGAAGAAGAAGAGGAGAGG + Intronic
1050287688 9:4119723-4119745 AAGGGTAAGAAGAATAGGAGAGG - Intronic
1050332086 9:4555763-4555785 CAGATTGAGATGAGCAGGAGAGG - Intronic
1050488029 9:6155718-6155740 TAGAATAAGAAGAACAGGCTGGG + Intergenic
1051088363 9:13378514-13378536 TGGATTTAGAAGGACAGAAGGGG + Intergenic
1052084800 9:24251523-24251545 TAACTGAAGAAGAGCAGGAGTGG - Intergenic
1052257651 9:26477647-26477669 TATTTTAAAAAGAAAAGGAGAGG + Intergenic
1052423702 9:28276364-28276386 TAGATTAATAAGAATAGATGAGG - Intronic
1053005960 9:34604795-34604817 GAGGTTAAGAAAAACTGGAGTGG + Intergenic
1053019024 9:34681867-34681889 TAGACTTAGAAGAAGAGGAAGGG + Intergenic
1053245525 9:36531638-36531660 TGGTTTAAGAAGAATAGTAGAGG + Intergenic
1053317742 9:37066561-37066583 TAAATTTAGGAGGACAGGAGGGG - Intergenic
1053322119 9:37108002-37108024 TAAATTTAGGAGGACAGGAGGGG - Intergenic
1054891416 9:70256521-70256543 CAGATAAACAAGCACAGGAGTGG - Intergenic
1055123398 9:72689755-72689777 TAGCTAAAAAAGAACAGGGGTGG - Intronic
1055503790 9:76927935-76927957 TAGAATAAAGAGAACAGGATTGG - Intergenic
1056206254 9:84322238-84322260 TAGAAGAAGAAGAAAAAGAGAGG + Intronic
1057820920 9:98329845-98329867 GAGAAGAAGAAGAAAAGGAGAGG - Intronic
1057859964 9:98633325-98633347 AAGAATAAGAAGAACAGGCCAGG + Intronic
1058115293 9:101078171-101078193 AAGAAGAAGAAGAAGAGGAGGGG + Intronic
1058363839 9:104183940-104183962 CTGATTAAGGAGAACAGGAAGGG - Intergenic
1059785694 9:117580795-117580817 TAGATGAAGAAGAAGAAAAGAGG - Intergenic
1060381702 9:123180956-123180978 TAGATAAACAAGAACAAAAGAGG - Intronic
1186302973 X:8220379-8220401 TTGATTAAGCAGTACAGGAAAGG - Intergenic
1186492625 X:9985888-9985910 TAGCTTACGAACAACATGAGAGG - Intergenic
1186576299 X:10769676-10769698 TTTATTGAAAAGAACAGGAGTGG - Intronic
1186694438 X:12015008-12015030 TATATAAAGAAGAAGAAGAGTGG + Intergenic
1188476606 X:30598996-30599018 TAGACTGGGAAAAACAGGAGTGG - Intergenic
1188985563 X:36765708-36765730 TGGAATAACAAGAACATGAGTGG - Intergenic
1189651211 X:43191709-43191731 AAGAGTGAGAAAAACAGGAGAGG + Intergenic
1190258603 X:48783696-48783718 TAGACTAATAATAACAGCAGCGG - Intergenic
1190566652 X:51737335-51737357 GAGATTAAGAAGCAGAGAAGAGG - Intergenic
1192105842 X:68316006-68316028 AAAATTAAAAAAAACAGGAGTGG + Intronic
1194416054 X:93613349-93613371 TCCATTTAGAAGAAAAGGAGTGG + Intergenic
1195202902 X:102566713-102566735 GAGAAGAAGAGGAACAGGAGTGG - Intergenic
1195412035 X:104577858-104577880 TATATTAAGAGTAATAGGAGTGG + Intronic
1195582660 X:106525447-106525469 TAGAAAAAGAAGAACAGGCCAGG - Intergenic
1195957978 X:110354211-110354233 TTGAGTAAGAAGAACAAGGGTGG + Intronic
1199219713 X:145304030-145304052 AAAATTAAGAAGAACAGGGAAGG - Intergenic
1199900164 X:152165309-152165331 GAGATGAAGAACAAAAGGAGAGG + Intergenic
1200257272 X:154590118-154590140 TAGATTGTGAAGAAGAGGCGGGG + Intergenic
1200260498 X:154614284-154614306 TAGATTGTGAAGAAGAGGCGGGG - Intergenic
1201849485 Y:18462439-18462461 GAGATTAAGATGATGAGGAGTGG - Intergenic
1201883833 Y:18857936-18857958 GAGATTAAGATGATGAGGAGTGG + Intergenic