ID: 1129817124

View in Genome Browser
Species Human (GRCh38)
Location 15:78565279-78565301
Sequence GGTCGCACCTGCCCAAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129817114_1129817124 25 Left 1129817114 15:78565231-78565253 CCTGCGATGCCAGCCTCAAGTCT No data
Right 1129817124 15:78565279-78565301 GGTCGCACCTGCCCAAAGGAAGG No data
1129817117_1129817124 12 Left 1129817117 15:78565244-78565266 CCTCAAGTCTTTGCCTTCCTGGA No data
Right 1129817124 15:78565279-78565301 GGTCGCACCTGCCCAAAGGAAGG No data
1129817118_1129817124 -1 Left 1129817118 15:78565257-78565279 CCTTCCTGGAACTCTGCTCCAGG No data
Right 1129817124 15:78565279-78565301 GGTCGCACCTGCCCAAAGGAAGG No data
1129817115_1129817124 16 Left 1129817115 15:78565240-78565262 CCAGCCTCAAGTCTTTGCCTTCC No data
Right 1129817124 15:78565279-78565301 GGTCGCACCTGCCCAAAGGAAGG No data
1129817121_1129817124 -5 Left 1129817121 15:78565261-78565283 CCTGGAACTCTGCTCCAGGGTCG No data
Right 1129817124 15:78565279-78565301 GGTCGCACCTGCCCAAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129817124 Original CRISPR GGTCGCACCTGCCCAAAGGA AGG Intergenic
No off target data available for this crispr