ID: 1129817380

View in Genome Browser
Species Human (GRCh38)
Location 15:78566387-78566409
Sequence TGTGCTCTAAGGAGCTAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 99}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129817380_1129817382 7 Left 1129817380 15:78566387-78566409 CCTCACTAGCTCCTTAGAGCACA 0: 1
1: 0
2: 1
3: 11
4: 99
Right 1129817382 15:78566417-78566439 TCAGCCTGCTGTTTTTCAAGAGG 0: 1
1: 0
2: 0
3: 15
4: 187
1129817380_1129817386 23 Left 1129817380 15:78566387-78566409 CCTCACTAGCTCCTTAGAGCACA 0: 1
1: 0
2: 1
3: 11
4: 99
Right 1129817386 15:78566433-78566455 CAAGAGGTTTTGGACAGGAATGG 0: 1
1: 0
2: 2
3: 25
4: 310
1129817380_1129817384 13 Left 1129817380 15:78566387-78566409 CCTCACTAGCTCCTTAGAGCACA 0: 1
1: 0
2: 1
3: 11
4: 99
Right 1129817384 15:78566423-78566445 TGCTGTTTTTCAAGAGGTTTTGG 0: 1
1: 0
2: 2
3: 23
4: 291
1129817380_1129817385 18 Left 1129817380 15:78566387-78566409 CCTCACTAGCTCCTTAGAGCACA 0: 1
1: 0
2: 1
3: 11
4: 99
Right 1129817385 15:78566428-78566450 TTTTTCAAGAGGTTTTGGACAGG 0: 1
1: 0
2: 0
3: 22
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129817380 Original CRISPR TGTGCTCTAAGGAGCTAGTG AGG (reversed) Intronic
902088132 1:13878946-13878968 ATTTCTCTAAGGAGCTGGTGGGG - Intergenic
904599138 1:31664240-31664262 TGGGCTCTGGGGAGGTAGTGAGG + Intronic
905925929 1:41749790-41749812 TGTGCTCTACGGAGCTCCGGGGG + Intronic
906238580 1:44227523-44227545 TGTCCTGTATGGAGCTGGTGGGG - Intronic
918068483 1:181118003-181118025 TGTGCTGTGATGAGCTCGTGTGG - Intergenic
921318443 1:213914493-213914515 TGTGCTCCGAGGTGCTAGTGGGG - Intergenic
922473041 1:225888311-225888333 TGGGCACTGAGGAGCTAGGGAGG + Intronic
922481044 1:225940281-225940303 TGGGCACTGAGGAGCTAGGGAGG + Intronic
1066188771 10:33036778-33036800 TGTGCTCAGTGGAGCCAGTGGGG + Intergenic
1070307374 10:75247807-75247829 TGGGCTTTTAGGAGCCAGTGGGG + Intergenic
1073687412 10:105770452-105770474 TTTGCTATAAGAAGCTTGTGTGG + Intergenic
1074293733 10:112162311-112162333 TGTGGTCTAATGAGCTAGGTAGG - Intronic
1074446697 10:113526559-113526581 TGTGCTGTAAGGATCAAATGAGG + Intergenic
1077819247 11:5719817-5719839 TGTGCTCACAGGAGGTGGTGGGG - Intronic
1078718209 11:13859545-13859567 GTTGCTCTAGGGAGCGAGTGGGG - Intergenic
1081605650 11:44525757-44525779 TGTGATATAGGGAGCTAGTTCGG + Intergenic
1081767514 11:45621752-45621774 TGTGCTCCATGGAGCTAGTAGGG - Intergenic
1094152967 12:27306367-27306389 TGTCCTTTAAGGAAGTAGTGAGG - Intronic
1095279643 12:40335104-40335126 TGTGCTGTAGGGTTCTAGTGAGG - Exonic
1096492612 12:52021007-52021029 TGGGCTCTAAGGAGGGAGGGAGG - Intergenic
1097510498 12:60532557-60532579 TGTGCTCTGATGAGAGAGTGAGG + Intergenic
1098123759 12:67269360-67269382 TTTGCCCTAGGGAGCGAGTGCGG + Exonic
1099148788 12:79081849-79081871 TGTGCTCTTAGAAGCTCCTGGGG - Intronic
1099155014 12:79163754-79163776 TGTGTTCTAAAGAGCTAATTTGG + Intronic
1099936517 12:89132512-89132534 TATGCTATAGGGAGGTAGTGTGG + Intergenic
1103385496 12:120529101-120529123 TGTGCTCTATGGAGCTATTGCGG - Exonic
1106146009 13:27050466-27050488 TGTGATCTAAAGAGCACGTGAGG - Intergenic
1106244399 13:27936064-27936086 AGTGCTCTAAGGGACTAGGGAGG - Intergenic
1107987492 13:45787795-45787817 TGTGCTTTAGGGAGCTACTGTGG + Intronic
1110819530 13:79898442-79898464 TGTACTCCAAGGAGCTAGGAGGG - Intergenic
1112415115 13:99197658-99197680 TGTCTTCTAAGGAGCAAGTGTGG - Intergenic
1113391874 13:109905674-109905696 TTTTCTCTAAGGAGTTAGAGAGG + Intergenic
1113449715 13:110399177-110399199 TGTGAGTTAAGTAGCTAGTGAGG - Intronic
1113585691 13:111462767-111462789 TGTGCTCCTGGGAGCTACTGAGG + Intergenic
1115778206 14:36739771-36739793 TATACTCTGAGGAGCAAGTGGGG - Intronic
1120561247 14:85995743-85995765 TGTGCCATTAGGAGCTAGGGTGG - Intergenic
1121600925 14:95202559-95202581 TATGCTCTGAGGATCAAGTGAGG - Intronic
1122034219 14:98935794-98935816 TGGTCTTTAAGGAGCTACTGAGG + Intergenic
1129817380 15:78566387-78566409 TGTGCTCTAAGGAGCTAGTGAGG - Intronic
1138054909 16:53822570-53822592 TGGGCTCTCATGAGCCAGTGTGG + Intronic
1138540597 16:57685139-57685161 TGTGCTAAGAGGAGCTGGTGAGG + Intronic
1139773903 16:69301426-69301448 TATGGTGGAAGGAGCTAGTGAGG - Exonic
1144610186 17:16704555-16704577 TGTGCTATTTGGATCTAGTGTGG + Intronic
1144902560 17:18610866-18610888 TGTGCTATTTGGATCTAGTGTGG - Intergenic
1144928502 17:18835111-18835133 TGTGCTATTTGGATCTAGTGTGG + Intergenic
1145129931 17:20335235-20335257 TGTGCTATTTGGACCTAGTGTGG + Intergenic
1149650491 17:58273330-58273352 TTGGCTCTAGGGAGCTAGGGTGG - Intronic
1150228965 17:63539463-63539485 TCTGGTCTAAGGAGACAGTGGGG - Intronic
1151157613 17:72137429-72137451 TGTCCTAAAAGGAGCTTGTGGGG - Intergenic
1151886250 17:76924888-76924910 TGGGCTCTAAGGAACTGGGGTGG + Intronic
1153354472 18:4120550-4120572 GGTGCTCAAAGCAGCTAGGGAGG + Intronic
1160825063 19:1075867-1075889 TGTGCTGGAAGGAGCTAGGAGGG - Intronic
1162559421 19:11407320-11407342 TGTTCACTAAGCAGCTAGTGTGG + Intronic
1166781455 19:45345594-45345616 TGAGCCCTGAGGAGCTGGTGCGG + Exonic
926801880 2:16666031-16666053 TCTGCTCCCAGGAGCTGGTGCGG + Intronic
927936004 2:27077163-27077185 TGTCCACTAAGGAGCAACTGAGG - Intergenic
930003420 2:46877337-46877359 TCTCCTCTAAGGCACTAGTGTGG - Intergenic
939934431 2:148273408-148273430 TGTTATATAAGGAGCAAGTGGGG - Intronic
946738919 2:222782627-222782649 GGTGCTCTTAGAAGCTAGTGTGG + Intergenic
1170274445 20:14568494-14568516 TGTGGTTTAGGGAGCAAGTGAGG + Intronic
1170327728 20:15175806-15175828 TGTGCTCCATAGAGCCAGTGGGG + Intronic
1175131358 20:56792016-56792038 TGTGCTCTCAGGTGCTAGGCAGG + Intergenic
1179037459 21:37771099-37771121 TGTGTTTTAAGGAGATAGTGTGG + Intronic
1184919626 22:47596570-47596592 TGCTCTTTAAGGAGCTTGTGGGG - Intergenic
953602936 3:44386406-44386428 CGTGCTCTACAGAGCTGGTGTGG + Intronic
956417120 3:69044174-69044196 TGTGCTATAAGGAGCTGATTGGG - Intronic
962080557 3:132135026-132135048 TTTGCTCTAAGAAGCTATAGTGG + Intronic
965077333 3:163995660-163995682 TTTGCTCAAAGAAGCTAATGGGG - Intergenic
966324935 3:178743371-178743393 AGTGCTTTAAGGAGGAAGTGTGG - Intronic
966570102 3:181431686-181431708 AATGCTCAAAGGAGTTAGTGAGG - Intergenic
971969958 4:33607306-33607328 TGTACTCTCAGGTGCTGGTGGGG - Intergenic
976152691 4:82107940-82107962 TGTTCTCTGAAGAGCTTGTGGGG - Intergenic
976659747 4:87527600-87527622 TGTGCCATGAGGAGCTACTGGGG + Intronic
986764955 5:10917073-10917095 TCTGCTGTAAGGACCTAGTGGGG + Intergenic
986777268 5:11027843-11027865 TGTGCAGAAAGGAGCTGGTGGGG + Intronic
987592791 5:19953078-19953100 TGTGCTCTAAGTATCTATTTTGG + Intronic
987620705 5:20336206-20336228 TCAGCTCCAAGCAGCTAGTGTGG + Intronic
991039791 5:62163113-62163135 TGTGCTCTATGGAGCCAGCAGGG - Intergenic
991124086 5:63050096-63050118 TGTGCTCCATGGAGATATTGGGG + Intergenic
992897411 5:81257366-81257388 TGTGCTCTAAAAAGCGGGTGGGG - Intronic
999125646 5:149244008-149244030 TGTGCTCTGTGGAGCCAGAGTGG - Intronic
999178784 5:149654141-149654163 TGAGCTATAAGGAGCAGGTGAGG - Intergenic
1001162789 5:169336185-169336207 TGTTTTCTAAGAAGCTTGTGGGG + Intergenic
1004527213 6:16420048-16420070 TGTTCTCTAAGGCACCAGTGTGG - Intronic
1005054008 6:21712546-21712568 TGTGCCCTAAGGAGGGAGGGTGG - Intergenic
1005703728 6:28430240-28430262 TGGGCTCTAAGGTGCTCGTTGGG - Intergenic
1006479617 6:34281233-34281255 TGGGCTCTGAGGAGGCAGTGAGG - Exonic
1007706990 6:43797231-43797253 AGAGCTCTCAGGAGCTAGTCTGG + Intergenic
1007945489 6:45823041-45823063 ACTGCTCTAAGGTGCTAATGTGG + Intergenic
1008335190 6:50295284-50295306 TCTGTTCTCAGCAGCTAGTGTGG + Intergenic
1009976977 6:70681926-70681948 AGTTCTCTAAGAAGCAAGTGTGG + Intronic
1013188987 6:107785928-107785950 TAGGCTGCAAGGAGCTAGTGAGG - Intronic
1017280674 6:152620967-152620989 TGTGCTATAAAGAGCTAGAGGGG + Intronic
1017936660 6:159011563-159011585 TGTCCTCTCAGAATCTAGTGAGG + Intergenic
1020036782 7:4968627-4968649 TGTGCACTCAGGGGCTTGTGTGG - Intergenic
1020223466 7:6260529-6260551 AGTGGGCTAAGGAGCTAGTGGGG - Intronic
1021913683 7:25410656-25410678 TCAGCTCCAGGGAGCTAGTGTGG - Intergenic
1025271785 7:57527879-57527901 TGTGCTATAAGGCTCCAGTGTGG - Intergenic
1029473193 7:100767342-100767364 GGTGCTCTAAGGAGCCAGAGAGG - Intronic
1031833875 7:126658693-126658715 TGTGCTCTAAGGAACTGGAATGG + Intronic
1038246486 8:25861127-25861149 TGTGCGCTGGGGAGCTAGAGAGG + Exonic
1043756181 8:84006077-84006099 CGTGCTCCATGGAGCCAGTGGGG - Intergenic
1047899729 8:129406792-129406814 TGTTCTCTATGGTGCTAATGAGG - Intergenic
1048996023 8:139794172-139794194 TCTGCTCTCAGGAGCTCCTGGGG - Intronic
1049038777 8:140097255-140097277 TGTGCACTCAGGACCTGGTGGGG - Intronic
1049230845 8:141480389-141480411 TGTGGTCCAAGGAGCTGCTGTGG - Intergenic
1056120544 9:83483512-83483534 TGTGCTTAAATGAGCTATTGTGG + Intronic
1056749686 9:89339081-89339103 TGTACTCTAAGGAGCCAGCCTGG + Intronic
1061551292 9:131336298-131336320 TTTGCTATAAGGACCCAGTGAGG + Intergenic
1188626064 X:32286153-32286175 TTTTCTATAAGGAGCTTGTGTGG + Intronic
1190382630 X:49854380-49854402 TGTGCTGAAAGATGCTAGTGAGG - Intergenic
1193614382 X:83670079-83670101 TGTGCTCTGAGATGGTAGTGTGG - Intergenic