ID: 1129825127

View in Genome Browser
Species Human (GRCh38)
Location 15:78629873-78629895
Sequence CAGCCACAGGACGCTGCCGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 167}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129825120_1129825127 14 Left 1129825120 15:78629836-78629858 CCTCAATCTTGCAGGCGCTCTTG 0: 1
1: 0
2: 0
3: 4
4: 77
Right 1129825127 15:78629873-78629895 CAGCCACAGGACGCTGCCGTTGG 0: 1
1: 0
2: 0
3: 12
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129825127 Original CRISPR CAGCCACAGGACGCTGCCGT TGG Exonic
901049486 1:6419234-6419256 CACTCACGGGGCGCTGCCGTGGG + Exonic
901230552 1:7639657-7639679 CAGCCTCAGGAGGCTGAAGTGGG + Intronic
902073425 1:13762515-13762537 CAGCCATTGGACGCTGGCCTAGG + Intronic
902488297 1:16762499-16762521 GAGCCACAGGAAGCTGCTGCAGG - Intronic
902558935 1:17264895-17264917 CAGCCTCAGGAGGCTGAAGTGGG + Intronic
902648324 1:17819557-17819579 CAGCCCCAGAATGCTGCCTTCGG + Intronic
906988568 1:50713046-50713068 CAGCTACAGGAGGCTGAGGTGGG + Intronic
908375974 1:63541674-63541696 CAGCCTCAGGAGGCTGAGGTAGG - Intronic
915489091 1:156241653-156241675 CACCCACAGCAGGCTGCCTTTGG + Intronic
915699841 1:157781366-157781388 CACCCACAGAAAGCTGCTGTGGG - Intergenic
917444064 1:175091932-175091954 AAGCCACAGGCCTCTGCTGTGGG + Intronic
917515902 1:175708186-175708208 TAGCCACAGGCCTCTGCCCTGGG + Intronic
918190574 1:182170180-182170202 CAGCTACAGGAGGCTGAGGTGGG + Intergenic
923085004 1:230696551-230696573 CAGCCACAGGACGCTGGAGGAGG - Intergenic
923532145 1:234820014-234820036 GGGCCACAGGACGCTGCTGCAGG + Intergenic
1063299723 10:4840637-4840659 CAGCCACATGAAGCTGCTGTGGG + Intronic
1067267965 10:44763499-44763521 CAGCAGCAGGATGCTGCAGTTGG + Intergenic
1067831234 10:49612234-49612256 CAGACACAGGACGCTCACGCAGG - Exonic
1073198724 10:101717301-101717323 CAGCTACAGGAGGCTGTGGTGGG - Intergenic
1080271573 11:30455943-30455965 CACAGACAGGACGCTGCCCTGGG + Intronic
1081574052 11:44308668-44308690 CAGCCACAGGAGGCAGGCCTGGG - Intronic
1083945062 11:65919074-65919096 CAGCCACAGGGCGGAGCCGCGGG + Exonic
1085053295 11:73390673-73390695 CAGGCACAGGACTCTGCCCCTGG - Intronic
1085409286 11:76281916-76281938 CAGCCACAGGGCCCTGCAGATGG - Intergenic
1087753316 11:102029043-102029065 CAGCCCCTAGACGCTGCCGCAGG + Intergenic
1090861937 11:130661741-130661763 CAGCCACAGGGAGCTGGTGTTGG + Intergenic
1091225325 11:133953678-133953700 CAGACAGAGGAGGCAGCCGTGGG + Intronic
1091454517 12:596808-596830 CAGCTACAGGAGGCTGAGGTGGG + Intronic
1095231317 12:39743234-39743256 CAGCTACAGTAGGCTGGCGTTGG - Intronic
1098493571 12:71110015-71110037 CAGCCCCTAGACGCTGCTGTGGG - Intronic
1103739722 12:123083104-123083126 CAGCTACAGGAGGCTGTGGTGGG + Intronic
1104746120 12:131211466-131211488 CCGACACAGGAGGCTGCTGTTGG - Intergenic
1107512942 13:41103230-41103252 CAGCTACAGGAGGCTGAGGTGGG + Intergenic
1110725393 13:78816926-78816948 CAGCCACAGGACGGGCCTGTTGG + Intergenic
1112948775 13:104963360-104963382 CAGTCACACGAGGCTGCCTTGGG + Intergenic
1113723130 13:112575946-112575968 CAGCCCCAGGACACTGCCTTTGG + Intronic
1113741354 13:112714335-112714357 CAGCCACAGGACCCCACTGTGGG + Intronic
1119601331 14:75979157-75979179 CAGCCACAGGAAGCTGGAGCGGG + Intronic
1121111068 14:91313460-91313482 CAGCCACAAGACGCAGACCTTGG - Exonic
1121742709 14:96265324-96265346 CAGCTACAGGAGGCTGAGGTGGG - Intronic
1122364160 14:101184251-101184273 CAACCCCCGGACGCAGCCGTGGG - Intergenic
1123919522 15:25060573-25060595 CAGGCCCAGGACCCTCCCGTGGG + Intergenic
1126684602 15:51236951-51236973 CATCCACAGGAATCTGCCGTGGG + Exonic
1128387170 15:67158020-67158042 CAGTCTCAGGAACCTGCCGTTGG - Intronic
1129825127 15:78629873-78629895 CAGCCACAGGACGCTGCCGTTGG + Exonic
1130669428 15:85898572-85898594 GAGCCACAGGATGCTGCAGAAGG - Intergenic
1132598216 16:762730-762752 CAGGAACAGGAGGCTGCCGAGGG - Exonic
1132711572 16:1271268-1271290 CAGGTACAGGACGCATCCGTGGG + Intergenic
1132788329 16:1670586-1670608 CAGCCTCAGGACCCTTCCGCTGG + Intronic
1137036779 16:35575032-35575054 CAGCATCAGCACGCTGGCGTGGG - Intergenic
1138077602 16:54057998-54058020 CACCCACAGGAAGAGGCCGTGGG - Intronic
1139595278 16:67954191-67954213 CAGCCACAGAACCCTGCTGGAGG - Intronic
1139964778 16:70739269-70739291 CAGCCTCAGGAAGCAGCAGTAGG - Intronic
1140250760 16:73292391-73292413 AAGCCACAGAATGCTGCCATGGG - Intergenic
1141825325 16:86475014-86475036 CAGCCTCTGGACTCTGCAGTAGG + Intergenic
1142272747 16:89099204-89099226 CAGCCAGAGGACACTGCCCACGG - Intronic
1142415034 16:89936597-89936619 CGGCCACAGGACGCAGGCCTGGG + Intergenic
1142469181 17:153213-153235 CTGCCACAGGTGGCTGCTGTGGG - Intronic
1143518772 17:7433713-7433735 CAGCCACAGGTGGCTGCTGGTGG + Intergenic
1143775541 17:9196410-9196432 CAGCCACAGGAGGCGGCAGCTGG - Intronic
1144249878 17:13405649-13405671 CATTCACAGGATGCTGCCTTGGG - Intergenic
1149521853 17:57323643-57323665 AGGCCACAGGACGCTGACCTAGG - Intronic
1150888492 17:69115968-69115990 CAGCTACAGGGAGCTGACGTGGG - Intronic
1151761783 17:76108258-76108280 CAGCTACAGGAGGCTGAGGTGGG - Intronic
1152484881 17:80583965-80583987 CAGCCACAGGCAGCTGCCCGAGG - Intronic
1156205698 18:34883421-34883443 CAGCTACAGGAGGCTGAGGTGGG - Intronic
1156370576 18:36468473-36468495 AGGCCACAGGAGTCTGCCGTGGG + Intronic
1156752539 18:40476744-40476766 CAGCTACAGGAGGCTGAGGTGGG - Intergenic
1157591059 18:48836646-48836668 AAGCCCCAGGAGACTGCCGTTGG + Intronic
1160015121 18:75134244-75134266 CAGCCAGAGGATGCTGCCCAGGG + Intergenic
1160971008 19:1767762-1767784 CAGGCCCAGGACGGTGCCCTGGG + Intronic
1165044495 19:33093996-33094018 CAGCCACAGCAGGCTGCACTGGG - Intronic
1167745536 19:51349557-51349579 CAGCCTCAGGAGGCTGAGGTGGG - Intronic
1168594461 19:57664318-57664340 GAGCCCCAGGACGCTGCTGGCGG + Intergenic
1202702900 1_KI270713v1_random:1741-1763 GAGCCACAGGAAGCTGCTGCAGG + Intergenic
929270737 2:39968947-39968969 CAGCCACAGGCAGCTGCCTCTGG - Intergenic
931827839 2:66019832-66019854 CAGCCACAGGAAGCTGGAGGAGG - Intergenic
932592026 2:73073326-73073348 CAGTTACAGGAGGCTGCTGTGGG - Intronic
934809174 2:97266385-97266407 CAGCCCCAGAACGCTGGCGGGGG + Intergenic
934809998 2:97269797-97269819 CAGCCCCAGGACACTGGCGGGGG - Intergenic
934827694 2:97438142-97438164 CAGCCCCAGGACACTGGCGGGGG + Intergenic
934828331 2:97490784-97490806 CAGCCCCAGAACGCTGGCGGGGG - Intergenic
935642255 2:105301848-105301870 CAGCCACAGGAAGCTGAGGCAGG - Intronic
937996651 2:127699204-127699226 CAGCCCCAGGACGGCACCGTGGG - Intergenic
943332424 2:186575500-186575522 CAGACACAGGACTCTGACTTAGG + Intergenic
944724902 2:202461119-202461141 CAGGCACAAGACGCTGCACTCGG + Intronic
947864680 2:233388086-233388108 CAGGCCCAGCACGCTGCCGGGGG - Intronic
948019643 2:234719984-234720006 CAGACACAGGACCCTGCCCTAGG - Intergenic
948334021 2:237193839-237193861 CAGTCTCAGGACCCTGCCCTGGG + Intergenic
1168848996 20:963899-963921 CAGGCACACGAGGCTGCGGTGGG - Intronic
1169133694 20:3182683-3182705 CAGCTACAGGAAGCTGAGGTGGG - Intergenic
1169195950 20:3682088-3682110 CAGCCTCAGGCCGCCGCCTTCGG + Exonic
1169549011 20:6682589-6682611 CAGCACCAGGAAGCTGCCTTGGG - Intergenic
1170745960 20:19099159-19099181 CAGCCACAGCCTGCTGCCTTCGG + Intergenic
1171459383 20:25290362-25290384 GAGCCACAGGAACCTGCCGTCGG - Intronic
1172045050 20:32074307-32074329 TAGGCACAGGACCCTGCCATGGG + Intronic
1178557419 21:33604943-33604965 CAGCAACAGGACACTACTGTGGG - Intronic
1180298560 22:11017313-11017335 CAGCCGCAGGAGGCAGCCCTTGG + Intergenic
1180601006 22:17015600-17015622 CTGCCACAGGAGGCAGCCCTTGG - Intergenic
1180836992 22:18934857-18934879 CAGCCACAGGTCCCTGCCCAGGG - Intronic
1180919897 22:19516283-19516305 CAGCCACAGTACCATGCTGTGGG + Intronic
1181808898 22:25391685-25391707 CAGCCTCAGGACGATCCTGTGGG + Intronic
1184482820 22:44758080-44758102 CAGCCAGAGGAAACTGCCATGGG - Intronic
1185334160 22:50264066-50264088 CAGCCTCAGGAAGCTGCTGTGGG + Exonic
1203287085 22_KI270734v1_random:160156-160178 CAGCCACAGGTCCCTGCCCAGGG - Intergenic
949544615 3:5061788-5061810 CTGCCACAGGACCCTGCAGCTGG + Intergenic
950396666 3:12738766-12738788 CAGCCACAGAAAGCTGCTGTAGG + Intronic
950679377 3:14574453-14574475 CAGCCACCTGATGCTGCCTTTGG - Intergenic
951957779 3:28275904-28275926 CAGCCACTGGGCTCTGCTGTGGG + Intronic
952392440 3:32891672-32891694 CTTGCACAGGAAGCTGCCGTTGG - Exonic
953872733 3:46641513-46641535 CAGCAGCAGGAGGCTGCCCTAGG + Intergenic
954007230 3:47601503-47601525 CATCCCCAGGAAGCTGCTGTGGG - Intronic
954646335 3:52133838-52133860 CAGCCACAGGGAGCTGCTGTGGG - Intronic
961054192 3:123774006-123774028 CAGCCCCAGGACCCTGCCAAGGG - Intronic
963051798 3:141149429-141149451 TGGCCACAGGAAGCTGCCTTTGG - Intergenic
965576963 3:170227309-170227331 CAGGCACATGATGCTGTCGTAGG + Intronic
973090112 4:46125067-46125089 CAACCCCAGGAGGCTTCCGTGGG - Intergenic
976725287 4:88210299-88210321 CAGCCACTGGAGGCTGAGGTGGG - Intronic
978233010 4:106423703-106423725 CAGCCTCAGGAGGCTGAGGTGGG + Intergenic
981156823 4:141447518-141447540 CAGCTACAGGAGGCTGGAGTGGG + Intergenic
982566899 4:156997071-156997093 CAGCCTCAGGACACTGCTCTTGG - Intergenic
1202766046 4_GL000008v2_random:149329-149351 CAACCGCAGGACACTGCTGTCGG - Intergenic
985954336 5:3252048-3252070 CAGCCACAGGACAGTGCTCTGGG - Intergenic
986234382 5:5893642-5893664 GAGCCACAGGCTGCTGCCCTGGG + Intergenic
986328912 5:6703116-6703138 CAGGCTCAGGAGGCTGCAGTGGG - Intergenic
986622618 5:9691447-9691469 CAGCCACAGGACGCAGACACAGG + Intronic
986773838 5:10996144-10996166 CAGCCACAGTCAGCTGCCCTAGG + Intronic
987358908 5:17088988-17089010 CAGCCTCAGGAGGCTGAGGTGGG - Intronic
988238405 5:28575809-28575831 GAGCCACAGGCCACTGCCCTGGG - Intergenic
990245403 5:53859215-53859237 CAGCCACAGGAGGGTGCAGGAGG - Intergenic
991176630 5:63695871-63695893 CAGCCACTGCACCCTGCCTTGGG - Intergenic
992474448 5:77088247-77088269 CTGCCCCTGGACACTGCCGTGGG - Intergenic
994092312 5:95820237-95820259 CAGCCACGGGAGGCTGAGGTGGG + Intronic
997210441 5:132073892-132073914 CAGCCCCAGCACGCAGCCCTGGG + Exonic
1000302912 5:159972177-159972199 CAGCCAGCGGACCCTGCCCTCGG + Exonic
1001819935 5:174702565-174702587 CAGCTACAGGAGGCTGAGGTGGG - Intergenic
1002097980 5:176843284-176843306 CAGGGGAAGGACGCTGCCGTGGG + Intronic
1002600570 5:180352297-180352319 CAGCCACAGGAGGCTGGAATGGG + Intronic
1002710429 5:181191831-181191853 CAGCCACAGAACTCGGCCGAGGG - Intergenic
1003637885 6:7850474-7850496 CAAGCACAGGAGGCTGCTGTTGG + Intronic
1003924619 6:10865402-10865424 GAGCCACAGGTCGCTGCAGTTGG + Intronic
1004420519 6:15465337-15465359 CAGCTACAGGAGGCTGAGGTGGG + Intronic
1004573198 6:16867903-16867925 CAGCTCCAGGACGCTGAGGTAGG + Intergenic
1006956565 6:37878561-37878583 CAGCCCCAGGGTGCTGCTGTGGG - Intronic
1008081129 6:47195511-47195533 CAGACACAGCACACTGCAGTGGG - Intergenic
1008954374 6:57199083-57199105 CAGCCACAGGCCTCTGCTGCAGG - Intronic
1016133472 6:140507305-140507327 CAGCCAAAGGAAGCTGAAGTTGG - Intergenic
1019493044 7:1323941-1323963 CCGCCCCAGGATGCCGCCGTTGG - Intergenic
1019786625 7:2981253-2981275 CATCCACAGGTCGCTGGGGTGGG - Intronic
1019807882 7:3141933-3141955 CAGCCTCAGGAGGCTGAGGTGGG + Intronic
1022534268 7:31086047-31086069 CAGCCAGAGGACCCTGCAGGAGG - Intronic
1023029515 7:36080093-36080115 CAACCACAGGACACTGCCACAGG - Intronic
1026150014 7:67779973-67779995 CAGCTACAGGAGGCTGAGGTGGG + Intergenic
1029201326 7:98841059-98841081 CATCCACAGCTCGCTGCCCTCGG - Intergenic
1032991139 7:137396117-137396139 CAGGCACAGCACGCAGCCCTTGG + Intronic
1033733507 7:144200494-144200516 CAGCCCCAGGAGGCTGAGGTGGG - Intergenic
1033749543 7:144350479-144350501 CAGCCCCAGGAGGCTGAGGTGGG + Intergenic
1034267673 7:149789123-149789145 CAGGCTCAGGACGCTGCTGTAGG - Intergenic
1034472321 7:151261915-151261937 AAGCCACTGGACGCTTCCTTGGG + Intronic
1034840224 7:154388628-154388650 CAGCCAGAGCACGCTGGCCTGGG - Intronic
1035180372 7:157085038-157085060 CAGCCACTGGGAGCAGCCGTGGG + Intergenic
1036711459 8:11082100-11082122 CTGCCAGAAGATGCTGCCGTCGG + Intronic
1038021030 8:23551945-23551967 CAGCCACAGGGCACTGGTGTTGG - Intronic
1040974506 8:53175139-53175161 GAGACACAGGAGGATGCCGTGGG + Intergenic
1042251903 8:66764580-66764602 CAGCTACAGGAGGCTGAGGTGGG - Intronic
1044727438 8:95204888-95204910 CAGCCACAGGACAGTGCCCAGGG - Intergenic
1048548237 8:135406694-135406716 CACCCACAGGAGGCTGCACTAGG + Intergenic
1049719389 8:144108602-144108624 CAGCCACAGCAGGCTGAGGTTGG - Exonic
1049760899 8:144331676-144331698 CAGCCGCCGGGCTCTGCCGTGGG + Exonic
1053665303 9:40313440-40313462 CAGCCTCAGGACACTGCTGCCGG + Intronic
1054519312 9:66062844-66062866 CAGCCTCAGGACACTGCTGCCGG - Intergenic
1057294143 9:93825669-93825691 CAGCTAGAGGAGGCTGCCATGGG - Intergenic
1057616628 9:96596745-96596767 CAGCTACAGGAGGCTGAGGTGGG + Intronic
1058800624 9:108541358-108541380 CACCCACAGGAGGCTGCCTGAGG + Intergenic
1062118538 9:134821951-134821973 CAGCCACAGGAGGCTGCTGAGGG + Intronic
1187676689 X:21723345-21723367 CACCCACAGGATGCTGTCCTTGG + Intronic
1191839535 X:65501844-65501866 CAGCCACCGAACGCTGGGGTTGG - Exonic
1195230274 X:102839906-102839928 CACCCACAGGACCTTGCAGTGGG + Intergenic
1195243812 X:102978790-102978812 CAGCCACAGGGCCCTGCTGATGG - Intergenic
1199371553 X:147055847-147055869 CAGCTACAGGAGGCTGAGGTGGG + Intergenic