ID: 1129827091

View in Genome Browser
Species Human (GRCh38)
Location 15:78641145-78641167
Sequence AGCTCGCGGCGGCTGCCACC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 77}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129827091_1129827098 -4 Left 1129827091 15:78641145-78641167 CCGGGTGGCAGCCGCCGCGAGCT 0: 1
1: 0
2: 0
3: 7
4: 77
Right 1129827098 15:78641164-78641186 AGCTCCGCTGTGGGGTCACAGGG 0: 1
1: 0
2: 1
3: 7
4: 142
1129827091_1129827104 29 Left 1129827091 15:78641145-78641167 CCGGGTGGCAGCCGCCGCGAGCT 0: 1
1: 0
2: 0
3: 7
4: 77
Right 1129827104 15:78641197-78641219 CCGCGCGGTCGAGTGAGCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 47
1129827091_1129827100 14 Left 1129827091 15:78641145-78641167 CCGGGTGGCAGCCGCCGCGAGCT 0: 1
1: 0
2: 0
3: 7
4: 77
Right 1129827100 15:78641182-78641204 CAGGGCACCCGTGAGCCGCGCGG 0: 1
1: 0
2: 2
3: 6
4: 100
1129827091_1129827097 -5 Left 1129827091 15:78641145-78641167 CCGGGTGGCAGCCGCCGCGAGCT 0: 1
1: 0
2: 0
3: 7
4: 77
Right 1129827097 15:78641163-78641185 GAGCTCCGCTGTGGGGTCACAGG 0: 1
1: 0
2: 0
3: 8
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129827091 Original CRISPR AGCTCGCGGCGGCTGCCACC CGG (reversed) Exonic