ID: 1129827094

View in Genome Browser
Species Human (GRCh38)
Location 15:78641156-78641178
Sequence CCCCACAGCGGAGCTCGCGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 72}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129827094_1129827104 18 Left 1129827094 15:78641156-78641178 CCGCCGCGAGCTCCGCTGTGGGG 0: 1
1: 0
2: 0
3: 5
4: 72
Right 1129827104 15:78641197-78641219 CCGCGCGGTCGAGTGAGCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 47
1129827094_1129827100 3 Left 1129827094 15:78641156-78641178 CCGCCGCGAGCTCCGCTGTGGGG 0: 1
1: 0
2: 0
3: 5
4: 72
Right 1129827100 15:78641182-78641204 CAGGGCACCCGTGAGCCGCGCGG 0: 1
1: 0
2: 2
3: 6
4: 100
1129827094_1129827105 24 Left 1129827094 15:78641156-78641178 CCGCCGCGAGCTCCGCTGTGGGG 0: 1
1: 0
2: 0
3: 5
4: 72
Right 1129827105 15:78641203-78641225 GGTCGAGTGAGCGCCGGTCCTGG 0: 1
1: 0
2: 0
3: 3
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129827094 Original CRISPR CCCCACAGCGGAGCTCGCGG CGG (reversed) Exonic