ID: 1129827096

View in Genome Browser
Species Human (GRCh38)
Location 15:78641159-78641181
Sequence TGACCCCACAGCGGAGCTCG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 1, 2: 0, 3: 10, 4: 100}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129827096_1129827104 15 Left 1129827096 15:78641159-78641181 CCGCGAGCTCCGCTGTGGGGTCA 0: 1
1: 1
2: 0
3: 10
4: 100
Right 1129827104 15:78641197-78641219 CCGCGCGGTCGAGTGAGCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 47
1129827096_1129827106 30 Left 1129827096 15:78641159-78641181 CCGCGAGCTCCGCTGTGGGGTCA 0: 1
1: 1
2: 0
3: 10
4: 100
Right 1129827106 15:78641212-78641234 AGCGCCGGTCCTGGCCCCCGAGG 0: 1
1: 0
2: 3
3: 7
4: 164
1129827096_1129827100 0 Left 1129827096 15:78641159-78641181 CCGCGAGCTCCGCTGTGGGGTCA 0: 1
1: 1
2: 0
3: 10
4: 100
Right 1129827100 15:78641182-78641204 CAGGGCACCCGTGAGCCGCGCGG 0: 1
1: 0
2: 2
3: 6
4: 100
1129827096_1129827105 21 Left 1129827096 15:78641159-78641181 CCGCGAGCTCCGCTGTGGGGTCA 0: 1
1: 1
2: 0
3: 10
4: 100
Right 1129827105 15:78641203-78641225 GGTCGAGTGAGCGCCGGTCCTGG 0: 1
1: 0
2: 0
3: 3
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129827096 Original CRISPR TGACCCCACAGCGGAGCTCG CGG (reversed) Exonic