ID: 1129827099

View in Genome Browser
Species Human (GRCh38)
Location 15:78641168-78641190
Sequence GGTGCCCTGTGACCCCACAG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 251}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129827099_1129827106 21 Left 1129827099 15:78641168-78641190 CCGCTGTGGGGTCACAGGGCACC 0: 1
1: 0
2: 1
3: 33
4: 251
Right 1129827106 15:78641212-78641234 AGCGCCGGTCCTGGCCCCCGAGG 0: 1
1: 0
2: 3
3: 7
4: 164
1129827099_1129827104 6 Left 1129827099 15:78641168-78641190 CCGCTGTGGGGTCACAGGGCACC 0: 1
1: 0
2: 1
3: 33
4: 251
Right 1129827104 15:78641197-78641219 CCGCGCGGTCGAGTGAGCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 47
1129827099_1129827108 29 Left 1129827099 15:78641168-78641190 CCGCTGTGGGGTCACAGGGCACC 0: 1
1: 0
2: 1
3: 33
4: 251
Right 1129827108 15:78641220-78641242 TCCTGGCCCCCGAGGTTTGCTGG 0: 1
1: 0
2: 2
3: 7
4: 133
1129827099_1129827105 12 Left 1129827099 15:78641168-78641190 CCGCTGTGGGGTCACAGGGCACC 0: 1
1: 0
2: 1
3: 33
4: 251
Right 1129827105 15:78641203-78641225 GGTCGAGTGAGCGCCGGTCCTGG 0: 1
1: 0
2: 0
3: 3
4: 41
1129827099_1129827100 -9 Left 1129827099 15:78641168-78641190 CCGCTGTGGGGTCACAGGGCACC 0: 1
1: 0
2: 1
3: 33
4: 251
Right 1129827100 15:78641182-78641204 CAGGGCACCCGTGAGCCGCGCGG 0: 1
1: 0
2: 2
3: 6
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129827099 Original CRISPR GGTGCCCTGTGACCCCACAG CGG (reversed) Exonic