ID: 1129827104

View in Genome Browser
Species Human (GRCh38)
Location 15:78641197-78641219
Sequence CCGCGCGGTCGAGTGAGCGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 47}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129827094_1129827104 18 Left 1129827094 15:78641156-78641178 CCGCCGCGAGCTCCGCTGTGGGG 0: 1
1: 0
2: 0
3: 5
4: 72
Right 1129827104 15:78641197-78641219 CCGCGCGGTCGAGTGAGCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 47
1129827091_1129827104 29 Left 1129827091 15:78641145-78641167 CCGGGTGGCAGCCGCCGCGAGCT 0: 1
1: 0
2: 0
3: 7
4: 77
Right 1129827104 15:78641197-78641219 CCGCGCGGTCGAGTGAGCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 47
1129827099_1129827104 6 Left 1129827099 15:78641168-78641190 CCGCTGTGGGGTCACAGGGCACC 0: 1
1: 0
2: 1
3: 33
4: 251
Right 1129827104 15:78641197-78641219 CCGCGCGGTCGAGTGAGCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 47
1129827096_1129827104 15 Left 1129827096 15:78641159-78641181 CCGCGAGCTCCGCTGTGGGGTCA 0: 1
1: 1
2: 0
3: 10
4: 100
Right 1129827104 15:78641197-78641219 CCGCGCGGTCGAGTGAGCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129827104 Original CRISPR CCGCGCGGTCGAGTGAGCGC CGG Exonic