ID: 1129827104

View in Genome Browser
Species Human (GRCh38)
Location 15:78641197-78641219
Sequence CCGCGCGGTCGAGTGAGCGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 47}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129827096_1129827104 15 Left 1129827096 15:78641159-78641181 CCGCGAGCTCCGCTGTGGGGTCA 0: 1
1: 1
2: 0
3: 10
4: 100
Right 1129827104 15:78641197-78641219 CCGCGCGGTCGAGTGAGCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 47
1129827094_1129827104 18 Left 1129827094 15:78641156-78641178 CCGCCGCGAGCTCCGCTGTGGGG 0: 1
1: 0
2: 0
3: 5
4: 72
Right 1129827104 15:78641197-78641219 CCGCGCGGTCGAGTGAGCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 47
1129827099_1129827104 6 Left 1129827099 15:78641168-78641190 CCGCTGTGGGGTCACAGGGCACC 0: 1
1: 0
2: 1
3: 33
4: 251
Right 1129827104 15:78641197-78641219 CCGCGCGGTCGAGTGAGCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 47
1129827091_1129827104 29 Left 1129827091 15:78641145-78641167 CCGGGTGGCAGCCGCCGCGAGCT 0: 1
1: 0
2: 0
3: 7
4: 77
Right 1129827104 15:78641197-78641219 CCGCGCGGTCGAGTGAGCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129827104 Original CRISPR CCGCGCGGTCGAGTGAGCGC CGG Exonic
903813254 1:26046369-26046391 CCGCGCGGGAGAGGGGGCGCAGG - Intergenic
909019042 1:70411178-70411200 CAGCGCGGCCCATTGAGCGCAGG - Intergenic
917962346 1:180154981-180155003 CCGCGGGGCCGCGTTAGCGCCGG - Exonic
1063410949 10:5836141-5836163 CCAGGAGGTCGAGTGAGCCCGGG - Intronic
1067015350 10:42753852-42753874 CCGCCCGGTCCCGTGAGCGCGGG + Intergenic
1067041282 10:42954504-42954526 CCGAGCAGTCTAGTGAGGGCTGG - Intergenic
1070800655 10:79242958-79242980 CTGCGCGCGCGAGTGAGTGCGGG + Intronic
1084065977 11:66704737-66704759 CCGGGCAGGCGAGCGAGCGCGGG - Exonic
1085401195 11:76236462-76236484 CCGCGCGGCGGAGGGAGCACCGG + Intergenic
1086322537 11:85665081-85665103 TGGCGCGGTCGAGTCATCGCAGG - Exonic
1094041194 12:26122924-26122946 CCCGGCGGCCGAGGGAGCGCCGG + Exonic
1102310775 12:111842656-111842678 CCGCGCGGCCGAGGGAGCAAAGG - Exonic
1122906091 14:104802172-104802194 CCACGCCGTCGGGTGAGAGCCGG - Exonic
1129827104 15:78641197-78641219 CCGCGCGGTCGAGTGAGCGCCGG + Exonic
1139486529 16:67259935-67259957 CCGCGCCGTAGGGTGAGAGCAGG + Exonic
1140675057 16:77319896-77319918 CCGGGCGGTTGAAAGAGCGCTGG + Exonic
1141597658 16:85107237-85107259 CCGGGAGGTAGAGTGAGAGCTGG - Intronic
1142206253 16:88784631-88784653 GGGGGCGGTCGAGCGAGCGCCGG - Intronic
1143140616 17:4739996-4740018 CCTCGCGGTGGAGGGTGCGCGGG - Exonic
1146008412 17:29176826-29176848 CCGCGCGGCGGCGTGAGGGCTGG - Intronic
1152049178 17:77959066-77959088 CGGCGCGGGCGAGTGGGCGGCGG - Intergenic
1153805473 18:8705882-8705904 CCGCGAGGTTGGGCGAGCGCGGG - Intronic
1155199375 18:23503731-23503753 CCGCGCGGGGGAGGAAGCGCGGG - Intronic
1161683893 19:5693817-5693839 CCGAGGGGTGGAGTGAGCACCGG - Intronic
1162798519 19:13098808-13098830 CCGCACGGTCGCGTTAGCGAAGG - Intergenic
1166014777 19:39971571-39971593 CCGTGCGGCCGAGTGATCCCCGG + Intronic
926077383 2:9951942-9951964 CCGCGCGGGCGGGCGGGCGCGGG + Intronic
926268162 2:11344604-11344626 CCGCGCGGGAGTGTGTGCGCCGG - Intronic
929313579 2:40452183-40452205 GCGGGCGGGCGAGTGTGCGCGGG - Intronic
929776267 2:44932903-44932925 CCTCGAGGTCGAGTGCGCCCTGG + Intergenic
931396142 2:61889545-61889567 CCGCGAGGTGGGGTGGGCGCCGG + Intronic
931602652 2:64019415-64019437 CCGCGCGGTGGATTGTGGGCTGG - Intergenic
934709995 2:96508505-96508527 CCGCACGCTGGAGTGGGCGCGGG - Intergenic
935692631 2:105744921-105744943 CCGCGCGGCCGAGCGGGCGGCGG + Exonic
1169048777 20:2558982-2559004 CCGCGCGGGGGAGTGGCCGCGGG + Intronic
1169849599 20:10035057-10035079 GCGCGCGGGCAGGTGAGCGCAGG - Exonic
1185333370 22:50261374-50261396 CGGCGCGGTGTGGTGAGCGCGGG - Exonic
954553312 3:51499785-51499807 CCGGGCGGCAGAGTGGGCGCCGG - Intronic
982584855 4:157222860-157222882 CTGCGCGGGGGAGCGAGCGCGGG - Intronic
989983098 5:50666613-50666635 CCGCGGGCGCGAGTGTGCGCGGG + Intronic
992476088 5:77102912-77102934 CCACGTGGTCAAGTGAGTGCTGG - Intergenic
1006123446 6:31821829-31821851 CCGCGCAGACGGGTGCGCGCTGG + Intergenic
1042217289 8:66439111-66439133 ACGCGGGGGCGAGTGAGAGCTGG - Intronic
1046890430 8:119416173-119416195 CCACGCGCTCGAGCGAGCCCTGG + Intergenic
1048981101 8:139703726-139703748 CCGCGCGCCCGGGTGGGCGCTGG - Intergenic
1049471752 8:142777829-142777851 CGGCGCGGGCGAGTGGGCGGAGG - Exonic
1060209016 9:121699207-121699229 CCGCGCGGCCGAGGGCGGGCCGG - Intronic
1062560470 9:137139385-137139407 CCGCGGGGCCGGGCGAGCGCAGG + Intronic
1189160588 X:38804919-38804941 CCGCGCGGACGTTGGAGCGCAGG - Exonic