ID: 1129829956

View in Genome Browser
Species Human (GRCh38)
Location 15:78662115-78662137
Sequence CTTCATTAACACCTGTGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 151}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129829956_1129829961 4 Left 1129829956 15:78662115-78662137 CCAGGGCACAGGTGTTAATGAAG 0: 1
1: 0
2: 1
3: 8
4: 151
Right 1129829961 15:78662142-78662164 AGGAATGGCCTCTTCCTAATGGG 0: 1
1: 0
2: 0
3: 43
4: 150
1129829956_1129829960 3 Left 1129829956 15:78662115-78662137 CCAGGGCACAGGTGTTAATGAAG 0: 1
1: 0
2: 1
3: 8
4: 151
Right 1129829960 15:78662141-78662163 GAGGAATGGCCTCTTCCTAATGG 0: 1
1: 0
2: 1
3: 7
4: 138
1129829956_1129829963 14 Left 1129829956 15:78662115-78662137 CCAGGGCACAGGTGTTAATGAAG 0: 1
1: 0
2: 1
3: 8
4: 151
Right 1129829963 15:78662152-78662174 TCTTCCTAATGGGCCTTTCAAGG 0: 1
1: 0
2: 1
3: 8
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129829956 Original CRISPR CTTCATTAACACCTGTGCCC TGG (reversed) Intronic
900883302 1:5397773-5397795 CTTCATAAACCCCTCTGCTCTGG + Intergenic
903077798 1:20786135-20786157 CTGCATTAACAGCTGTGACCGGG - Intronic
903779782 1:25813948-25813970 CTTCATCAGCACCTGGTCCCTGG + Exonic
904400846 1:30255543-30255565 TGTCATTAACACCTGGGCCCTGG + Intergenic
905225539 1:36476476-36476498 CTTCAATAGCTCCTGTGGCCTGG + Intronic
906017603 1:42596151-42596173 CTTCATGAGGACCAGTGCCCAGG + Intronic
915927578 1:160035035-160035057 CTTCATTAAAACATGTCCACTGG + Intergenic
916442677 1:164842914-164842936 TTTCATTAACAACTGTGCGGTGG - Intronic
918532874 1:185542302-185542324 CTTCATTAAGTCCTTTGTCCTGG - Intergenic
919067155 1:192706992-192707014 CTTCATTTACATCTCTGCCATGG + Intergenic
920536702 1:206742040-206742062 CTTCATAGACACTTGTGCCTGGG + Intergenic
921231796 1:213080779-213080801 GGTCTTTAACACCTGTGCTCAGG + Intronic
921569470 1:216761064-216761086 AGACATTAACACCTGTCCCCAGG - Intronic
922720260 1:227896674-227896696 CATGATTAAAGCCTGTGCCCAGG + Intergenic
1063957566 10:11280891-11280913 CCCCATTGACACCTGTGCCCAGG + Intronic
1070989205 10:80716506-80716528 CACAATTAACACCTTTGCCCAGG + Intergenic
1071027076 10:81127629-81127651 CTTCCAGAACACCTGTGCCTGGG - Intergenic
1072911187 10:99502941-99502963 CATCATTAAAACCTGTGCCATGG - Intergenic
1073340119 10:102737986-102738008 CTTCCTCAACCCCTGTCCCCTGG + Exonic
1074108800 10:110408331-110408353 CTTGATTTGCATCTGTGCCCTGG + Intergenic
1075435127 10:122433411-122433433 CATCATTAGGATCTGTGCCCAGG + Exonic
1076449704 10:130548507-130548529 CTTCCTTGACATCTGTGCCTGGG + Intergenic
1076997994 11:308387-308409 CTTCATGAACACCTGCTGCCTGG + Exonic
1081238459 11:40675393-40675415 CTGAGTTAACACCTGTGACCAGG - Intronic
1082219812 11:49620949-49620971 CCTAATTTACACCTGTGCCTGGG + Intergenic
1082837315 11:57660836-57660858 TGTCATTAACACCTGTGGCTGGG + Exonic
1084145630 11:67263774-67263796 CTTCATTGATTCCTGGGCCCAGG - Intergenic
1086629823 11:89003837-89003859 CCTAATTTACACCTGTGCCTGGG - Intronic
1087011367 11:93517040-93517062 CTTTATCATCACCTGGGCCCAGG - Intronic
1090425203 11:126602748-126602770 CTTGATAAACCCCTCTGCCCTGG + Intronic
1092475734 12:8817709-8817731 CCTTGGTAACACCTGTGCCCTGG + Intergenic
1092758523 12:11787952-11787974 TTTCTTTCACACCAGTGCCCTGG + Intronic
1104478858 12:129090238-129090260 CTTTATTATCATCTGTGGCCTGG + Intronic
1106665276 13:31845499-31845521 CTGTATTAACACTTGAGCCCGGG - Intergenic
1107621144 13:42232000-42232022 CTTCACTGACACCTGTTTCCAGG + Intronic
1107814744 13:44234283-44234305 CTACAGGAACACCTCTGCCCTGG + Intergenic
1109122461 13:58475147-58475169 CTTTATGGACACCTGTGGCCTGG - Intergenic
1110261312 13:73488171-73488193 CTTCATTCAGCCATGTGCCCTGG - Intergenic
1113280284 13:108781104-108781126 ATTCACTATCACCTGTGCCCAGG + Intronic
1114647117 14:24262055-24262077 CTGCATTGACACCGCTGCCCCGG + Exonic
1114717509 14:24843378-24843400 TTCCATTAACTCCTGTGTCCAGG + Intronic
1115196725 14:30808548-30808570 CTTCATTAGTAGCTGTGTCCTGG - Intergenic
1118424334 14:65643330-65643352 GGTCATTAACATCTGTGACCTGG + Intronic
1120012579 14:79434420-79434442 CTTCATGAACACCTGCCACCTGG + Intronic
1120935081 14:89887720-89887742 ATTCCATAACACCTGTTCCCAGG - Intronic
1121237120 14:92400053-92400075 CTTTATTTAAAACTGTGCCCTGG - Intronic
1121737742 14:96230315-96230337 ATACATAAACAGCTGTGCCCAGG + Intronic
1124634303 15:31355113-31355135 TCTCATAAACACCTGTGTCCTGG - Intronic
1125430538 15:39589065-39589087 CCTCATCAACATCTGTGCACTGG - Exonic
1129677859 15:77642190-77642212 CTCCATTAAGACCTGAGTCCAGG + Intronic
1129793954 15:78362024-78362046 CTTCATTCAAAGCTGTTCCCAGG + Intergenic
1129829956 15:78662115-78662137 CTTCATTAACACCTGTGCCCTGG - Intronic
1130129458 15:81126486-81126508 CTTCATTAACAAATGTGGGCAGG + Intronic
1130504787 15:84528754-84528776 CTTCTTTAACTCCCTTGCCCTGG + Intergenic
1130696913 15:86140166-86140188 ATTGATTAACACCTGTGGGCGGG - Intergenic
1131231512 15:90663338-90663360 CTTCTTTTACATCTGTGCTCAGG - Intergenic
1132091833 15:98953586-98953608 CTGCGTTCACACCTCTGCCCTGG - Intronic
1136140056 16:28282613-28282635 ATTCATTCACACTTGTTCCCAGG - Intergenic
1136871794 16:33813748-33813770 CTTCCTGAAATCCTGTGCCCTGG - Intergenic
1137056069 16:35747243-35747265 CTTCATTCCCACCACTGCCCAGG + Intergenic
1138243235 16:55445960-55445982 CTCCTTCAACACCAGTGCCCAGG - Intronic
1141028192 16:80567408-80567430 CTTCATTACCACATCTGCCTTGG + Intergenic
1141720678 16:85753606-85753628 CAACATTGCCACCTGTGCCCTGG + Intergenic
1203100378 16_KI270728v1_random:1302310-1302332 CTTCCTGAAATCCTGTGCCCTGG + Intergenic
1143575163 17:7788040-7788062 CTTCATTCACCCTTGTGTCCTGG - Intronic
1143699483 17:8647578-8647600 CTTCCCAAACACCTGTGGCCAGG - Intergenic
1146527213 17:33577383-33577405 CTTCCTTTACACCTCTCCCCTGG - Intronic
1147767113 17:42844665-42844687 CCTCATTACCATCTTTGCCCTGG + Exonic
1147924902 17:43940273-43940295 CTTGAATACCTCCTGTGCCCAGG + Intergenic
1148795725 17:50195796-50195818 GTTCACTAACACCTTTGTCCTGG - Intronic
1149404397 17:56332279-56332301 CTTCACAAGCACCTGTTCCCTGG - Intronic
1150302468 17:64057801-64057823 CTTCATCATCACCTATCCCCTGG - Exonic
1154194880 18:12258306-12258328 CTTCGTAAGCACCTGTGCTCCGG - Intronic
1159801683 18:72907985-72908007 AATCATTAACAGCTGTGCCAAGG + Intergenic
1159873333 18:73783336-73783358 CTTAAGTAACACCTGTTCCCAGG + Intergenic
1159928038 18:74286005-74286027 TTTCAGTAACTCCTGTTCCCAGG - Intronic
1159939320 18:74394571-74394593 GTTTATTAACACCTGTGGGCAGG + Intergenic
1162361587 19:10223796-10223818 CTCCATGAACCCCTCTGCCCTGG + Intronic
1164633761 19:29778150-29778172 CTTCAGGATCAGCTGTGCCCAGG + Intergenic
1164802030 19:31084939-31084961 CTGCATTTATACCTTTGCCCGGG - Intergenic
1164886672 19:31784128-31784150 CTTCATTCAAACCTGTGCAGAGG + Intergenic
1165552095 19:36595602-36595624 CTACTTGAACACCTGAGCCCAGG + Intronic
927041582 2:19235986-19236008 CTTCACAAACACCTGGGGCCAGG - Intergenic
928132075 2:28659753-28659775 CTTCCTGCACACCTGTCCCCGGG + Intergenic
928684169 2:33730974-33730996 CTCCCTTAACACCTCTTCCCTGG + Intergenic
930096735 2:47571313-47571335 CTTCGTTCACTCCTTTGCCCTGG + Intergenic
934490772 2:94760923-94760945 CTACATTAGCATCTGTGCCTAGG + Intergenic
935144217 2:100383564-100383586 CTACATTATCATCTGTGACCAGG + Intergenic
937525106 2:122758954-122758976 ATTCATTATCACCTGTGCATTGG + Intergenic
938278694 2:130050067-130050089 CTACATTACCATCTGTGCCTAGG + Intergenic
938329669 2:130440926-130440948 CTACATTACCATCTGTGCCTAGG + Intergenic
938360277 2:130680577-130680599 CTACATTACCATCTGTGCCTAGG - Intergenic
938436679 2:131287285-131287307 CTACATTACCATCTGTGCCTAGG - Intronic
941489837 2:166129757-166129779 ATTCATTAAAACATGTGGCCAGG - Intergenic
942277412 2:174333405-174333427 CTATATTAAAACCAGTGCCCAGG + Intergenic
943326560 2:186505820-186505842 CCTCATCACCACCTGTTCCCTGG - Exonic
946554756 2:220843609-220843631 ATTCATTAACACTTAAGCCCAGG + Intergenic
948147178 2:235716536-235716558 CTTAATGAGCACCTGTGCCTGGG + Intronic
1172002806 20:31793497-31793519 CTTCATTAAAACATGTGACTGGG - Intronic
1173224078 20:41151771-41151793 CTTCCTTCCCACCTGTGTCCAGG + Intronic
1173308578 20:41875247-41875269 CAGCATTAACACCTGTACCATGG - Intergenic
1175657062 20:60780170-60780192 TTTCATTATCTCCAGTGCCCAGG - Intergenic
1175678131 20:60964877-60964899 CTTCAGGAACACCTGGACCCAGG + Intergenic
1183525044 22:38317647-38317669 CGTCTTTTCCACCTGTGCCCTGG - Intronic
1184130683 22:42514880-42514902 TCTCCTTAGCACCTGTGCCCCGG - Intronic
955017849 3:55089234-55089256 CTTTATTCACTCTTGTGCCCCGG + Intergenic
955120961 3:56058109-56058131 CTTGATAAACAGCTGTGCTCTGG + Intronic
961884536 3:130087840-130087862 CTGCATGAACATCAGTGCCCAGG + Intronic
965299979 3:166996950-166996972 CTACTTTAGCACTTGTGCCCAGG + Intergenic
965597602 3:170423636-170423658 CTTTTTGAACACCTATGCCCAGG + Intronic
970316084 4:14829578-14829600 CTTCCTTCACACCTGTGAGCTGG + Intergenic
970616621 4:17773956-17773978 CTTCATTAACACTTGTGTTTGGG + Intronic
971460373 4:26889660-26889682 CCTCATTAGCACCTGTAGCCAGG + Intronic
978833942 4:113124671-113124693 CTTCATTAGCAACTTTGCCAGGG + Intronic
979349536 4:119628438-119628460 CTTCGTTCACCCCTGTTCCCAGG - Intronic
981031024 4:140126074-140126096 CCTCTTTAACACCTGTACCTTGG - Intronic
981288732 4:143049151-143049173 TTTCATTTACACCTATGCTCTGG + Intergenic
982429072 4:155301003-155301025 TTACATTAACAACTTTGCCCGGG + Intergenic
987040663 5:14059229-14059251 CTTCAGCACCAGCTGTGCCCTGG + Intergenic
989718424 5:44493638-44493660 CTTCTTTCAAACCAGTGCCCAGG - Intergenic
995079245 5:108028581-108028603 CCTCTTTAACCCCTGTGCTCTGG + Intronic
996004067 5:118400068-118400090 CTGCATCATCACCAGTGCCCTGG - Intergenic
996669387 5:126099506-126099528 CTTCATAAGTTCCTGTGCCCAGG - Intergenic
996898345 5:128513200-128513222 CTTAAATAACACCTGTCTCCAGG - Intronic
997760045 5:136436934-136436956 CTTTATTAACACAAGTGCCAAGG - Intergenic
1000453555 5:161420596-161420618 CTTCTGTAAGACCTGTGGCCAGG + Intronic
1000627624 5:163557337-163557359 TTTCATGTACAACTGTGCCCAGG - Intergenic
1002490022 5:179569207-179569229 CTGCCTTTTCACCTGTGCCCTGG - Intronic
1002665779 5:180823499-180823521 CTGCAGCAACTCCTGTGCCCAGG + Intergenic
1006272510 6:32974985-32975007 CTTCCTTAACTTTTGTGCCCTGG + Intronic
1006690630 6:35881157-35881179 GTTCATTACCAGATGTGCCCTGG + Intronic
1007328197 6:41080028-41080050 CTCCATTCACACCAGTGCCCTGG + Intronic
1010635696 6:78256813-78256835 CTTCATCTTCATCTGTGCCCTGG - Intergenic
1013106839 6:107032931-107032953 CTGCTTTCACATCTGTGCCCTGG + Intronic
1013428493 6:110035624-110035646 CTTGGTTACCACCTGTTCCCTGG + Intergenic
1013826739 6:114220497-114220519 CTTAAGTAACGTCTGTGCCCTGG - Intronic
1017020110 6:150133282-150133304 TTTAAATAACACCAGTGCCCAGG + Intergenic
1019630987 7:2049702-2049724 CTTCATCAGCACCAGTGTCCAGG + Intronic
1025023332 7:55496694-55496716 CTCCCTTAACACCTGTGCCCAGG - Intronic
1028939871 7:96509318-96509340 CTTTATTATCATCTGTGCTCAGG + Intronic
1029192386 7:98781077-98781099 CAACATTAACACCTGTGGCAGGG + Intergenic
1034684144 7:152954945-152954967 CTTCATGAACACGAGTGCTCTGG + Intergenic
1035599887 8:891167-891189 CCTCAATCACACCTGTGGCCTGG - Intergenic
1039582374 8:38677407-38677429 CTTCAGAAACACCAGTACCCGGG + Intergenic
1049966993 9:788876-788898 CCTCATTAGACCCTGTGCCCTGG - Intergenic
1052881348 9:33602594-33602616 CTACATTAGCATCTGTGCCTAGG - Intergenic
1053129990 9:35609343-35609365 CTTCATCAGCACCTGTTCCTCGG + Exonic
1053299815 9:36940967-36940989 CTTCATTACCCCTTGTGCCTGGG - Intronic
1053494969 9:38543248-38543270 CTGCATTAGCATCTGTGCCTAGG + Exonic
1053916800 9:42949876-42949898 CTACATTAGCATCTGTGCCTAGG - Intergenic
1056303869 9:85270162-85270184 CTTCCCTAACACTTCTGCCCAGG - Intergenic
1056965758 9:91161762-91161784 CTTCCCTGACACCTGTGCCTGGG + Intergenic
1057719683 9:97521926-97521948 TTTCATTAACAACTATTCCCAGG + Intronic
1058970647 9:110079620-110079642 CTCCATTTATACCTCTGCCCTGG - Intronic
1059379303 9:113910712-113910734 CTTCCTTCACACCTGTGCTCAGG + Intronic
1189870900 X:45381757-45381779 CATCATTAACACTAGTGGCCAGG + Intergenic
1190381361 X:49842289-49842311 CTTCATAAACAACTGGACCCGGG + Intergenic
1195570190 X:106392011-106392033 CTTCACTAAGCCCTGTGCTCTGG + Intergenic
1196437603 X:115688991-115689013 CTGCATTCACACCTGGGCCATGG + Intergenic
1199508772 X:148596358-148596380 CTTCATGGCCACTTGTGCCCTGG + Intronic
1201282411 Y:12353111-12353133 TTTGATTAACCACTGTGCCCTGG - Intergenic