ID: 1129830379

View in Genome Browser
Species Human (GRCh38)
Location 15:78665700-78665722
Sequence TCACATGCATAATGTCTTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 10, 3: 36, 4: 259}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129830379_1129830380 -4 Left 1129830379 15:78665700-78665722 CCTTGAAGACATTATGCATGTGA 0: 1
1: 0
2: 10
3: 36
4: 259
Right 1129830380 15:78665719-78665741 GTGAAGTAAGCCAGTAACAAAGG 0: 1
1: 5
2: 39
3: 197
4: 569

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129830379 Original CRISPR TCACATGCATAATGTCTTCA AGG (reversed) Intronic
902064749 1:13675366-13675388 TCACTAGTATAATGTTTTCAAGG + Intergenic
903912076 1:26734947-26734969 TCACAATCATAATGCCTTTAGGG - Intronic
905859137 1:41335635-41335657 TCACTAGTATAATGTCCTCAGGG + Intergenic
908516895 1:64901894-64901916 TCACCTACACAATGTCCTCAGGG + Intronic
909121229 1:71606585-71606607 TCACATCTAAAATGTCTTGATGG + Intronic
910868757 1:91812433-91812455 CTACATGCATAATTTCTTCTTGG + Intronic
912788676 1:112629455-112629477 TCACTAGCATACTGTCCTCATGG - Intronic
913394870 1:118355799-118355821 TAACATGCAGAATACCTTCATGG - Intergenic
917563954 1:176192064-176192086 TCACTTGCATTATCTTTTCATGG - Intronic
917891954 1:179448396-179448418 TCACATGCATAATGGATGAAAGG - Intronic
918085831 1:181244574-181244596 TCGCATGTATCATGTCTGCATGG + Intergenic
918409735 1:184245865-184245887 TCACATGCATTTTCTCTTGATGG - Intergenic
919587586 1:199458020-199458042 TCACCTACAAAATGTCCTCATGG - Intergenic
919722010 1:200847903-200847925 TCATAATCATACTGTCTTCAAGG - Intronic
920393543 1:205627005-205627027 TCACTTGCATAATGTTTTCAAGG - Intronic
920800746 1:209185146-209185168 TTACATGAATAAGGTCTTTAGGG - Intergenic
922401305 1:225259839-225259861 TCACTAGCATAATGTCCTCCAGG + Intronic
922908521 1:229195783-229195805 TCATTAGCATAATGTTTTCAAGG - Intergenic
923550950 1:234962749-234962771 TCTGATGCAGAATGTTTTCAGGG + Intergenic
1062889071 10:1043517-1043539 CCACATGCATAGTCTCTGCATGG + Intronic
1063062572 10:2572163-2572185 TTATAAGAATAATGTCTTCATGG - Intergenic
1063231356 10:4068635-4068657 TTACCTGCATTATTTCTTCATGG + Intergenic
1065254152 10:23848392-23848414 TAACATTCATAAAGTGTTCATGG + Intronic
1066174011 10:32885064-32885086 TTACATGCCTCATATCTTCATGG - Intergenic
1066679977 10:37928798-37928820 TCACTAGCTTAATGTCCTCAGGG + Intergenic
1066696145 10:38079310-38079332 ACACAGGCATAATGTATTCAAGG + Intergenic
1066996390 10:42568210-42568232 ACACAGGCACAATGTATTCAAGG - Intergenic
1069849078 10:71393470-71393492 TGACATCCATCCTGTCTTCAAGG - Intergenic
1069872166 10:71539885-71539907 ACACATGCAGCCTGTCTTCAAGG - Intronic
1070229666 10:74551550-74551572 TCACTTTCACAATGTCTTCTGGG - Intronic
1071096556 10:81981938-81981960 TCACATCCATAATTTCTTTATGG + Intronic
1071242385 10:83722101-83722123 AACCAAGCATAATGTCTTCAAGG - Intergenic
1075874010 10:125791679-125791701 TCACTAGCATAGTGTTTTCAAGG - Intronic
1076845425 10:133067056-133067078 TCACAGGCATAATGAATTCCGGG - Intergenic
1077955134 11:7010098-7010120 ACACATGCTTATTGTCTTTATGG - Intronic
1078076360 11:8165392-8165414 TAACTAGCATAATGTTTTCAAGG - Intronic
1079800625 11:24863412-24863434 TCACTTGGATCATGTTTTCAAGG - Intronic
1080035847 11:27710121-27710143 TCAAATCCATTATGTGTTCATGG + Intronic
1083529273 11:63403930-63403952 TAACCTCCATAGTGTCTTCATGG - Intronic
1086380347 11:86245582-86245604 TCACATGCAAACTGATTTCAGGG - Intronic
1088096919 11:106111925-106111947 CCACATGAATATTGTCCTCAAGG - Intergenic
1088270475 11:108029021-108029043 AAACATGCTTAATGTATTCAAGG - Intronic
1088581064 11:111317408-111317430 TTACATGTATAAGTTCTTCAGGG - Intergenic
1089044064 11:115484046-115484068 TAACATGCAAAATGTCCACAAGG + Intronic
1090018299 11:123105019-123105041 GCACAGGCAGAATGCCTTCAGGG + Intronic
1090288246 11:125518974-125518996 TCACTTCCATAATGTTTTCAAGG - Intergenic
1090816354 11:130300021-130300043 TCACTCGCATAATGTCTTCAAGG - Intronic
1091736574 12:2927153-2927175 TTACTTGCATAATGTTTTCAGGG + Intronic
1095670392 12:44852976-44852998 TCAGAGGCTTAGTGTCTTCAAGG + Intronic
1096017826 12:48294603-48294625 TGACCTACATAATGCCTTCAGGG - Intergenic
1096204445 12:49708991-49709013 TCACAGGCATGATGGCTTCAAGG + Intronic
1096204608 12:49710355-49710377 TCGCAGGCATGATGGCTTCAAGG - Intronic
1097520190 12:60658090-60658112 TCAAATGCTTAATTTCTTCCTGG + Intergenic
1098779863 12:74673243-74673265 TCAAATCCATAATATCTTCAAGG + Intergenic
1099391922 12:82092041-82092063 TCACATGAATAAGTTCTTTAGGG + Intergenic
1099460985 12:82920821-82920843 TCACATGTAAAGTATCTTCAGGG + Intronic
1103873659 12:124110280-124110302 TCACATGCATAATGTCAGTCTGG + Intronic
1103913896 12:124366300-124366322 TCACGCGCATCGTGTCTTCAGGG - Intronic
1104665524 12:130644846-130644868 TCACATGCTGACTGACTTCAAGG + Intronic
1105596603 13:21845095-21845117 ACAAATTCATAATGTCTACATGG - Intergenic
1105778913 13:23689543-23689565 TCCTTAGCATAATGTCTTCAAGG - Intergenic
1106202702 13:27554515-27554537 TTACTTGCATAATATTTTCAGGG + Intronic
1106371002 13:29132634-29132656 TCACTTATATAATGTCCTCAGGG + Intronic
1107040863 13:35945760-35945782 TCACAAGTATAGTGTCCTCAGGG - Intronic
1107092106 13:36492962-36492984 TCACAGCCATGATGTCTTTAAGG - Intergenic
1108349176 13:49574946-49574968 TTATTAGCATAATGTCTTCAGGG - Intronic
1109233885 13:59792183-59792205 TCACGTGCTTAAAGTCTGCAGGG + Intronic
1110417925 13:75272277-75272299 TACCTAGCATAATGTCTTCAAGG - Intergenic
1110515744 13:76410652-76410674 TGACTAGCATAATTTCTTCATGG - Intergenic
1110915071 13:81011411-81011433 TCATAGGCATAATGGCTTTATGG + Intergenic
1111149162 13:84225951-84225973 TCAAATGCACAATCTCTTCCTGG - Intergenic
1113819895 13:113205699-113205721 TCCCTTGCATCATGTTTTCAGGG - Intronic
1114334230 14:21671319-21671341 TCAAATACATAATTTGTTCAAGG + Intergenic
1114889652 14:26902128-26902150 TTACATTCATGCTGTCTTCAGGG + Intergenic
1115062742 14:29213210-29213232 TCAAATGCAAAAGGTCTGCATGG + Intergenic
1115495423 14:33999551-33999573 TCACTTGCATAATGTTTTCAAGG - Intronic
1115588216 14:34836435-34836457 ACACATGCAGAATTTCTACAGGG + Intronic
1116190850 14:41663596-41663618 ACATATGAGTAATGTCTTCACGG - Intronic
1117095306 14:52291303-52291325 TGACCTGCACAATGTCTACATGG - Intergenic
1117559912 14:56926741-56926763 TCACTTGCATAGTGTCATCAGGG + Intergenic
1117777715 14:59199607-59199629 TCACAAACTCAATGTCTTCAAGG - Intronic
1117875029 14:60243433-60243455 TTACATGCATTGTGTCTGCATGG - Intergenic
1117989040 14:61415964-61415986 TGCTTTGCATAATGTCTTCAGGG + Intronic
1120123840 14:80716528-80716550 TCATATGCATGAAGTTTTCAAGG + Intronic
1120552020 14:85884358-85884380 TCATCTGCATTATGTATTCATGG + Intergenic
1122021056 14:98838370-98838392 TCACTAGCACAATGTTTTCAAGG - Intergenic
1122591365 14:102854066-102854088 TAACTTACATAATGTTTTCAGGG + Intronic
1124430589 15:29604546-29604568 TGAGATGTATAATGACTTCAGGG - Intergenic
1124963458 15:34415353-34415375 TCACCAACATAATGTTTTCAGGG + Intronic
1124980079 15:34561579-34561601 TCACCAACATAATGTTTTCAGGG + Intronic
1125380154 15:39078910-39078932 TCACCAGCATAATGCTTTCAAGG - Intergenic
1125530355 15:40409180-40409202 TCAGAAGCATATTGTCTGCAGGG - Intronic
1125781302 15:42271008-42271030 TTCTATGCATACTGTCTTCACGG - Intronic
1126346025 15:47694941-47694963 TCACATGCCTATGGTGTTCAGGG - Intronic
1129702031 15:77773730-77773752 TCATATGCTTAAAATCTTCACGG - Intronic
1129830379 15:78665700-78665722 TCACATGCATAATGTCTTCAAGG - Intronic
1131603163 15:93870784-93870806 TCACATGGCTGATGTCTTAATGG + Intergenic
1131937371 15:97521646-97521668 TCACATGCAGATTGACTACAGGG - Intergenic
1131957870 15:97757024-97757046 TCACCTGCTTGATGCCTTCACGG - Intergenic
1132168602 15:99623185-99623207 TCCCTTACCTAATGTCTTCAAGG + Intronic
1136313505 16:29432818-29432840 AAACATGGATCATGTCTTCATGG - Intergenic
1136326946 16:29534583-29534605 AAACATGGATCATGTCTTCATGG - Intergenic
1136441637 16:30274568-30274590 AAACATGGATCATGTCTTCATGG - Intergenic
1137956344 16:52834649-52834671 TCAGATACATAATGTCTTGGTGG + Intergenic
1138756777 16:59496143-59496165 CCACATGTATAATATCCTCATGG + Intergenic
1139553437 16:67689961-67689983 TGGCTAGCATAATGTCTTCAAGG + Intronic
1139687738 16:68617342-68617364 TCACTAGCATAATGTTCTCAAGG - Intergenic
1139888429 16:70228300-70228322 AAACATGGATCATGTCTTCATGG - Intergenic
1140183554 16:72745729-72745751 CCACTTACATAATGTTTTCAAGG - Intergenic
1143161009 17:4871098-4871120 TCATAAGCATAATGTCTTCAAGG + Intronic
1144359388 17:14477565-14477587 TCATTAGCATAATGTTTTCAAGG - Intergenic
1145353309 17:22109831-22109853 TAACATACATTATGTCTTCTGGG + Intergenic
1146439928 17:32885052-32885074 TCCCCTGTATAATTTCTTCAGGG - Intergenic
1146819577 17:35974112-35974134 TCACCAGCATAGTGTCGTCAAGG - Intergenic
1147749755 17:42722943-42722965 GCAGATGCATGATGGCTTCATGG - Intronic
1149663493 17:58349749-58349771 TCACCAACATAATGTCTTCAAGG - Intronic
1150265833 17:63831947-63831969 TCACTTCCATAATTTCTTGATGG - Exonic
1152154607 17:78624632-78624654 TCACTTACATAATGTTTTCAAGG - Intergenic
1153584945 18:6611634-6611656 TCTCATGCATAATGGAATCAAGG + Intergenic
1155236196 18:23821800-23821822 TCACATACATAAAGTCTAAATGG - Intronic
1155560347 18:27069548-27069570 TCACAAGCATAAAGTCTTGATGG + Intronic
1155708236 18:28843100-28843122 TTACATGGATAAATTCTTCAAGG + Intergenic
1156327740 18:36089517-36089539 TCACTTAGATAATGTTTTCAAGG - Intergenic
1156481626 18:37440065-37440087 TCACATGGCTAATGGCTCCAAGG - Intronic
1156892878 18:42209912-42209934 TCACTTTAAAAATGTCTTCATGG + Intergenic
1157065030 18:44339677-44339699 TTACATGGATAATTTCTTTATGG + Intergenic
1157122615 18:44925797-44925819 TCACATCCATTAGGACTTCAGGG + Intronic
1157518958 18:48331665-48331687 TCACATGCAAAAAGATTTCAGGG - Intronic
1158261952 18:55616254-55616276 TCACTAGCATAATGTCCTCCAGG + Intronic
1158672955 18:59493248-59493270 TCACATGCATAAAATCCTCAAGG + Intronic
1159058816 18:63493284-63493306 TCTTTTCCATAATGTCTTCAAGG + Intronic
1163564964 19:18045644-18045666 TCAGGTGCATAATGTCCTCTGGG + Intergenic
1164303076 19:23979126-23979148 TCTCATGCATAAAGCCCTCAGGG - Intergenic
1166173979 19:41052435-41052457 TCACTTGGTTAATCTCTTCATGG + Intergenic
1168454376 19:56494828-56494850 TCACTTGTATAATGTCCTCAAGG + Intergenic
925546617 2:5023821-5023843 TCACCTCCATAATGTCTTCCAGG + Intergenic
925755623 2:7128950-7128972 TTACATGTCTAATTTCTTCATGG - Intergenic
929059623 2:37910174-37910196 TAAAATGTATAATGTCTACAGGG - Intergenic
930170928 2:48251014-48251036 TGACTGGCATAATGTCTTCAAGG - Intergenic
931000426 2:57774249-57774271 TCATATGGCTAATGTATTCATGG - Intergenic
931552723 2:63464748-63464770 TCACTTACATAATGTCCTCAAGG - Intronic
932843613 2:75111130-75111152 TCACGTGCAGAAGTTCTTCATGG + Intronic
934045078 2:88166597-88166619 TCACCTGCATAATATTTTCACGG + Intergenic
935233068 2:101116209-101116231 ACAGATGCATAATGTCCACAAGG + Intronic
936243015 2:110804694-110804716 TCACTTGCATAATGTTTTCAGGG - Intronic
937161260 2:119764064-119764086 TCACAAGCATTATGTCTGAAAGG + Intronic
938604737 2:132880887-132880909 TAAAATGCATCATGTCTACAAGG - Intronic
940335636 2:152524521-152524543 TTAAATTAATAATGTCTTCATGG - Intronic
941686647 2:168455340-168455362 TCACAGGCCTAATGCCTTAAAGG + Intergenic
942222324 2:173782270-173782292 TGACATTTATAAAGTCTTCAAGG - Intergenic
942396846 2:175558736-175558758 TCACAAACATAATGTGTTGAAGG + Intergenic
945157491 2:206854993-206855015 TCACTTGGATAATGTCTCCAAGG - Intergenic
945229407 2:207569716-207569738 TTACATGAATAAACTCTTCATGG - Intronic
945671037 2:212803058-212803080 TGACAGTCAGAATGTCTTCATGG + Intergenic
947702359 2:232245023-232245045 CCACATGGATAATTTCTTCAAGG - Intronic
1169174143 20:3494203-3494225 TCACCTGCATTAAGTCTTCGTGG - Intronic
1171069601 20:22055392-22055414 ACATATCCCTAATGTCTTCAAGG + Intergenic
1171482936 20:25467669-25467691 TCACATTCCTAAAGTCTTCGTGG - Intronic
1173633685 20:44536088-44536110 TCACTAGCATAGTGTCCTCAAGG + Intronic
1174591736 20:51650734-51650756 TAACATGCAGAGTGTCTCCATGG - Intronic
1174768933 20:53280193-53280215 TCATATGCCTGAGGTCTTCAAGG - Intronic
1175406007 20:58729156-58729178 ACTTAAGCATAATGTCTTCAAGG - Intergenic
1175520741 20:59601245-59601267 TTACTTGCATAATGTTTTCCAGG + Intronic
1176004245 20:62851102-62851124 TCTCATGTATTACGTCTTCAAGG + Intronic
1176661494 21:9639118-9639140 TAACATGTATAATTCCTTCATGG + Intergenic
1176996928 21:15565789-15565811 TGAAAAGCATAAAGTCTTCAAGG + Intergenic
1177689037 21:24479654-24479676 TCACCTACATAATGTCCTCCAGG - Intergenic
1179031262 21:37721631-37721653 TCATTTAAATAATGTCTTCAAGG - Intronic
1179596393 21:42445738-42445760 TCCCCTGCAAAATGTCTCCAGGG + Intronic
1182966255 22:34524066-34524088 TCACATGCATAGGGACTGCATGG - Intergenic
1183696626 22:39427346-39427368 CCACATGCCTAATCTCTTCCAGG - Intronic
1184300006 22:43553051-43553073 TCACATTCTTAATGTCTTTACGG + Intronic
1185393389 22:50574489-50574511 TCACAGGCTTGATTTCTTCACGG + Exonic
949330350 3:2915892-2915914 TCATTAGCATAATGTCCTCAAGG - Intronic
949948049 3:9205839-9205861 TCACTTGCATAATGTCCTCGAGG - Intronic
950040947 3:9918662-9918684 TCACATGCATTATCTCTTTGAGG + Intronic
950579969 3:13855668-13855690 TCACCTGCAAAATGGGTTCAAGG + Intronic
950639330 3:14338462-14338484 TCACCTGCCTAATGTTTTCAAGG - Intergenic
950974775 3:17228964-17228986 TCCCATGAATAATATTTTCATGG + Intronic
951301274 3:21000166-21000188 TCACATGCTCAGTGTGTTCATGG + Intergenic
952504085 3:33991868-33991890 TCATCAGCTTAATGTCTTCAGGG - Intergenic
956143681 3:66171179-66171201 AAATATTCATAATGTCTTCAGGG - Intronic
957549429 3:81684794-81684816 TGACATGCCTAATGTTTTCAGGG - Intronic
957861114 3:85951731-85951753 ACACTTGCATGATGACTTCAAGG + Intronic
958172091 3:89950403-89950425 TCACATTCAAAATGTCTTAGTGG + Intergenic
958600355 3:96289028-96289050 TCACATGCAGAATCTCTGCTAGG + Intergenic
958633868 3:96717072-96717094 TCACTTGCATCATGTCCTCCAGG - Intergenic
958893704 3:99807438-99807460 TGACTGGCATAATGTCCTCAAGG - Intergenic
960452316 3:117825721-117825743 TTATTTGCATGATGTCTTCAAGG - Intergenic
961507450 3:127379479-127379501 TCACCTGCAAAATGTTATCAAGG + Intergenic
962147720 3:132857876-132857898 TCACTTGCATAATATCCTCAAGG - Intergenic
962147761 3:132858387-132858409 TCACTTGCATAATGTCCTCAAGG + Intergenic
963677131 3:148326440-148326462 TAGTAAGCATAATGTCTTCAAGG - Intergenic
963960256 3:151302100-151302122 TCTCATGCAAAACGTTTTCACGG - Intronic
964383555 3:156123245-156123267 GCAAATGTGTAATGTCTTCAAGG - Intronic
965887595 3:173466813-173466835 TCACTTACCTAACGTCTTCAGGG + Intronic
967052218 3:185795252-185795274 TCATTAGCAAAATGTCTTCATGG + Intronic
967513253 3:190337142-190337164 TCCCATGAATACTGTCTTCCAGG - Intronic
970795940 4:19913680-19913702 TGACATACATAATCTGTTCATGG - Intergenic
974303714 4:60104215-60104237 TCAAAGGCATAGTGTCTTCTAGG + Intergenic
974510669 4:62836213-62836235 TCTCATTCACTATGTCTTCACGG + Intergenic
975385719 4:73757389-73757411 CACCTTGCATAATGTCTTCAAGG + Intergenic
975809286 4:78149499-78149521 TCACATGGAAAATGTCTAGAGGG - Intronic
976230399 4:82836577-82836599 TGACTGGCATAATGTCTTCCAGG - Intronic
976889075 4:90022933-90022955 TCACTTGCATATTTTCTTAATGG - Intergenic
978711033 4:111781378-111781400 TCACTTGCATAATGTTTCTAAGG - Intergenic
978851084 4:113337458-113337480 TCACATGAATAATCTGTTCTAGG + Intronic
979220888 4:118222946-118222968 TCACTTGAATAATATCTGCATGG - Intronic
979798012 4:124871393-124871415 TCACTTACATAATGTCCTCCAGG + Intergenic
981298342 4:143158263-143158285 CCACATGCATTACGTCTTTAAGG + Intergenic
981867614 4:149443118-149443140 TCACAGGCAGGATTTCTTCAGGG + Intergenic
981975114 4:150718039-150718061 ACACATGCACAATGTTTACAAGG + Intronic
982276030 4:153638092-153638114 ACACTTACATAATGTTTTCAAGG - Intergenic
984630506 4:182055462-182055484 TGACATGCATACTATCCTCAAGG - Intergenic
984783488 4:183546920-183546942 TCACTGGCATAATGTCCTGAAGG + Intergenic
986723070 5:10573883-10573905 TCACATACTTAATGACATCAAGG + Intronic
992556695 5:77910713-77910735 TCACTTGCATAATTTCCTCTTGG + Intergenic
995120089 5:108526734-108526756 TCACTTAGATAATGTGTTCAAGG + Intergenic
996171339 5:120295234-120295256 ACACAGTCATAATGTCTTCTGGG + Intergenic
996224755 5:120978073-120978095 TCACTAACATAATGTTTTCAAGG + Intergenic
999126079 5:149247160-149247182 TCTTAAGCATAATGTTTTCAAGG - Intronic
999362867 5:151000612-151000634 TCATTAGCATAATGTTTTCAAGG + Intergenic
1002151662 5:177238094-177238116 TAGCATACATAATGTCTTCAAGG + Intronic
1002647650 5:180668903-180668925 TCACACGCCTAGTGTCTTCCTGG - Intergenic
1003169566 6:3710474-3710496 TCACACACAGAATGACTTCACGG - Intergenic
1003785425 6:9480391-9480413 TTCCATGCATAATTTCTTCCAGG - Intergenic
1004634979 6:17458159-17458181 TCCCATTCATAATGTCATAATGG + Intronic
1004853690 6:19727064-19727086 TCACAAGCATACTGTCTAAATGG + Intergenic
1004991061 6:21139326-21139348 TAAAATGCACAATGTCATCAAGG + Intronic
1006438147 6:34037276-34037298 TCACAGTCATTGTGTCTTCAGGG - Intronic
1010873818 6:81075962-81075984 GCACATGCATAATTATTTCATGG - Intergenic
1012009658 6:93767185-93767207 TCAGCTCCATAATTTCTTCAGGG - Intergenic
1015147127 6:129999830-129999852 TGACATGCATAATCTCTGTATGG - Intergenic
1015344297 6:132137568-132137590 TCACTAGCATGATGTCTTCCAGG - Intergenic
1015566395 6:134576024-134576046 CCACATGCATAACATCTTCCTGG - Intergenic
1015759770 6:136645598-136645620 ACACATGCAGACTTTCTTCAAGG + Intronic
1016548792 6:145254415-145254437 TTACAAGTTTAATGTCTTCAAGG + Intergenic
1018162658 6:161061738-161061760 TCATTTGCATAATGTTTTCAAGG + Intronic
1019142762 6:169958673-169958695 CCACAAGCTTAACGTCTTCAAGG - Intergenic
1019353629 7:567738-567760 TCACTTGCATAGTGTCCTCAAGG - Intronic
1020726679 7:11823652-11823674 AGACATGTATAATCTCTTCAAGG - Intronic
1021352208 7:19608778-19608800 TCACTGCCATAATGTCCTCAAGG - Intergenic
1021392856 7:20115787-20115809 TCCCTTGCATACTATCTTCATGG + Intergenic
1021603303 7:22386161-22386183 TCATTAGCATAATGTCTTCAAGG + Intergenic
1022267997 7:28776824-28776846 TCACTTACATAATGTTTTTAAGG + Intronic
1022385587 7:29895925-29895947 TCACTTACATAATATTTTCAAGG - Intronic
1023533169 7:41180838-41180860 TCACATCAAAAATGTCTTCAAGG + Intergenic
1025274162 7:57560270-57560292 TAACATACATTATGTCTTCTGGG - Intergenic
1025740210 7:64189229-64189251 TGACAATCATAATGTGTTCAAGG + Intronic
1030175395 7:106648438-106648460 TCAGTTTCAAAATGTCTTCACGG + Intergenic
1031154235 7:118090053-118090075 TCAGATTCATAATGTCATGAAGG - Intergenic
1031448956 7:121890443-121890465 ACACTTGCATCATGTCTTCTTGG + Intronic
1031461597 7:122057103-122057125 TCACATGCAAAATTTCCTCTTGG + Intronic
1031722622 7:125194816-125194838 TCACAAGCATAGTGTCTGAAAGG + Intergenic
1032967843 7:137121660-137121682 TCACAGGCATTCTGTCTTCCTGG + Intergenic
1034586445 7:152097712-152097734 TCACAAGCATAATGTTTTCAAGG - Intronic
1035542928 8:456133-456155 TCACAAGAATTATGTCTTCCAGG - Intronic
1035770162 8:2140656-2140678 TCACACGCACAATGTCTACAGGG - Intronic
1039031165 8:33311171-33311193 TGGCATGCAGAAGGTCTTCATGG - Intergenic
1039602223 8:38849454-38849476 TTACATGCTGAAAGTCTTCATGG + Exonic
1039631012 8:39111022-39111044 TCACTTGCATAATGTTTTCAAGG + Intronic
1039759279 8:40557452-40557474 ACACTTGCATGATATCTTCAGGG - Intronic
1041476221 8:58269704-58269726 TCACATGAAAAATGTATTAATGG - Intergenic
1041621083 8:59970242-59970264 TCACTTGTATAATGTCCTCAAGG + Intergenic
1043508864 8:80930548-80930570 TTGCATGCATAATGTTTCCATGG + Intergenic
1043986768 8:86702446-86702468 TCAAATGTATAAAATCTTCATGG - Intronic
1044120683 8:88390697-88390719 TCACATGGGTAATGTCCTCCAGG - Intergenic
1044236295 8:89834624-89834646 TACTAAGCATAATGTCTTCAAGG - Intergenic
1044462691 8:92464395-92464417 TTACATGGATAAGTTCTTCAGGG - Intergenic
1045688834 8:104739646-104739668 GTATATGCATAATGTCTTTAAGG + Intronic
1046213456 8:111111029-111111051 TCACAAGCATTCTGTCTGCATGG + Intergenic
1046562918 8:115862608-115862630 TTACATGCATAATGTCTATGTGG - Intergenic
1046862863 8:119114066-119114088 TCAAATGCATGATGCCTACACGG + Intergenic
1049151727 8:141039325-141039347 TCAAAAGCATAATGTCCTCAAGG + Intergenic
1051407646 9:16755877-16755899 TCAGATTCACAATGTCTCCAAGG - Intronic
1051631978 9:19148944-19148966 AGACATGAAGAATGTCTTCAAGG - Intronic
1051867882 9:21702183-21702205 ACACAATCATAATGTCTTCTAGG + Intergenic
1053232143 9:36419283-36419305 TCCCATGCATACTGCCTTCAGGG - Intronic
1053240605 9:36491737-36491759 TCACTCGCATAATGTTTACAAGG + Intergenic
1053420822 9:37976576-37976598 TCAGTTTCATAATGTTTTCAAGG + Intronic
1054956950 9:70922322-70922344 TCCCATGCATTATGTCATTAAGG + Intronic
1055641874 9:78325127-78325149 TCACATGCACAGTAGCTTCAGGG + Intronic
1056083733 9:83124074-83124096 TCATTTGCATAATGTCTTCAAGG + Intergenic
1057249085 9:93485197-93485219 TCCCAGGCAAAATGTCTTAAGGG - Intronic
1057603732 9:96482775-96482797 TCACTTGCATCATTTTTTCAAGG + Intronic
1058054293 9:100434033-100434055 ACATGTGCATTATGTCTTCATGG + Intronic
1058639698 9:107070876-107070898 TCACATGCATAATTGTTCCAGGG + Intergenic
1059641847 9:116224922-116224944 TCACATTCACATTGTCTTCATGG - Intronic
1061224745 9:129274598-129274620 TCACTAGCATAATATCCTCAAGG - Intergenic
1203639059 Un_KI270750v1:140961-140983 TAACATGTATAATTCCTTCATGG + Intergenic
1186948232 X:14593105-14593127 AAACATGCATAATGTCACCATGG + Intronic
1188234214 X:27706992-27707014 TCATTAGCATAATGTTTTCAAGG - Intronic
1188237474 X:27747702-27747724 TCACACAAATAATGTCTTCCAGG + Exonic
1188447821 X:30274858-30274880 TTACAGGCATAATGTCCTCCAGG - Intergenic
1189379621 X:40492998-40493020 TCACTAGCATAATGTTCTCAGGG - Intergenic
1189805933 X:44735766-44735788 TCACCAGCATAATATCTTCAAGG - Intergenic
1194856896 X:98941667-98941689 TCCTTAGCATAATGTCTTCAAGG - Intergenic
1196164545 X:112524110-112524132 TCACTTACATAATGTCTTCCAGG + Intergenic
1196553285 X:117056573-117056595 TCAAATGAATAACATCTTCAGGG - Intergenic
1197711100 X:129668472-129668494 TCACTAGCATAATGCTTTCAAGG + Intergenic
1198027910 X:132726788-132726810 TCACTCACATAATGTTTTCAAGG + Intronic
1198083176 X:133258781-133258803 TCACTTACATAATGTCTTCAGGG - Intergenic
1199063407 X:143386604-143386626 TAACATGCATAAATTTTTCAAGG + Intergenic
1199570453 X:149262201-149262223 TCAGCTGCATGATGGCTTCAGGG + Intergenic
1199731723 X:150640139-150640161 AAACATGCAAAATGTTTTCATGG - Intronic
1201944232 Y:19494638-19494660 TCACTTGCATAATATCTTAAAGG - Intergenic